Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BSC1
Systematic Name YDL037C
Strain S288c
Description Protein of unconfirmed function, similar to cell surface flocculin Muc1p; ORF exhibits genomic organization compatible with a translational readthrough-dependent mode of expression
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>BSC1 YDL037C
ATGAGCCAACAGAATATACTACATTATGATATGGATGTTACTTCCGTATCATGGGTCAAG
GATAACACATACCAGATTACTATTCATGTCAAAGCCGTAAAAGATATCCCTTTGAAATAT
TTATGGTCTTTAAAGATTATTGGTGTCAACGGTCCCTCAAGCACCGTACAACTTTACGGC
AAAAATGAGAAGACATACCTAATCAGTGATCCAACAGATTTTACATCCACTTTTCAGGTT
TATGCTTACCCTTCTTCTGACGGTTGCACAGTTTGGATGCCAAATTTCCAAATCCAGTTC
GAATATCTACAAGGTGATGCTGCTCAGTACTGGCAAACTTGGCAATGGGGGACAACCACC
TTCGATTTATCGACAGGTTGTAACAATTATGACAATCAAGGCCACTCACAAACGGATTTC
CCTGGATTTTATTGGACCTACCAGTGCAAGGGAAACAATGATGGCACTTGTACAAAAGCC
TCGTCTTCATCCATTACTACTTCATCCATTACTACTTCATCCACTACTACTTCATCCACT
ACTACTTCATCCACTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCT
ACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCT
ACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCTACTACTTCATCCTCT
ACTACTTCATCCTCTACGAAAACTTCCACTACTACGTCATCTACTGTGAAAAGCTCTTCC
ACTACATCCATTGATTTTACTACTTCCGTTGACTCACATACTTCATCAAGCGTAGCCGAT
ATTTATCGTTCAAGAACATCTACTGATGTCACCACATTAGCAGCTTCAACTAGTCCTTTC
AGCAGTTTCACTTCAAGTGACTCTAGTAGTTCAAGCGATGTAACCAGTTCAACCATTCAA
ACTACTTCTGTTGATCCAACCACTTAA
Promoter Sequence
Download FASTA
>BSC1 YDL037C
TATGGCTTACGTAAACATTATTTCTTTGATATACTATTCCGTTAGAATGGAAGGGGGCCA
TATGATTCTGATTTTCTTGGCCTGGGGGGATGGAAATTTTCCTTTTAGAGCTGCCTGTAC
AAGACCGAGTGTTCGTTCCTCCTTTAGCATAGAAAATACGGTTATTAGATTATTGGGGCA
TTTGGCCTGCTTCCATCTTAACGCGAACAAATACTATTCAAGAACTTGTGCTACCTCTTG
AAACCAAATGTTAAACTGTTCTGCCATATTTGAAAATAATTTCAAAGTTGTGGGAAAAAT
ATTTTGCCATCATACGACAAACGTTTCTCTGGCTGTGACTGATAGTCGTGTAGGTCCTGT
ATTATCTTGCTGACAAACATCTTAAAAAGTCTTTTGGAAAAAGAAAAAAATAAACTTTCC
TTCTTTTTTTTTTGGTTCCTGCGGCTCTTTCAAGGGGCTGCCAAACCTTATATTCTCCTC
CTGTCATTTTAGAAGGAGAGGTAGCGGTCTTTTCTTTTTTTTCGTGCCTACACGCGCACA
TGACGATAAAACTGGCCCAGGCGAGATCAGATCAGCATTTGCACGTTGCATTTTACTTGT
TTTCTTATTGGCAAAGAAAAAAAGCTCGGAACAAGCCACTAATACCCGATTCTATGCTTA
CAGAATAACCGATACTACTGGAAAGAAAAATTTTTCACATTAGTTCGCTGCATCTCCATG
ATCGTTTAATTATTTTATATTTAAGAGAAGCAAATCACTTCCTCCAATGTCATGATGGTC
TTGGCAATTTTCCTCCCCTTGTTGCAAAAGTGTAAAATAGGTATCCACATCATTCATAAG
AAAACTACTAATATCATTTTGCCTCCTATTTGCGGCCTTGCTCACAAATTCAGCGACTGC
TGATAGAATTGATGACAAGGTGAGCCCTTCATTTGATCTAAGCAAAAGAGACGAAAGCGT
TGCTATCAATGGTTGTCCAAATTTGGATTTCAACTGGCAC
Chr coordinates Chr IV from 385587-384601
w3c xhtml validator w3c css validator