Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS16B
Systematic Name YDL083C
Alias rp61R, S16B, S9, uS9
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; homologous to mammalian ribosomal protein S16 and bacterial S9; RPS16B has a paralog, RPS16A, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>RPS16B YDL083C
ATGTCTGCCGTCCCAAGTGTCCAAACTTTTGGTAAGAAGAAATCAGCTACCGCTGTTGCC
CACGTCAAGGCCGGTAAGGGTTTGATTAAGGTCAACGGTTCTCCAATCACTTTGGTTGAA
CCAGAAATCCTAAGATTCAAGGTCTACGAACCATTATTGTTGGTTGGTTTGGACAAGTTC
TCCAACATCGATATCAGAGTTAGAGTCACTGGTGGTGGTCATGTTTCTCAAGTCTACGCC
ATCAGACAAGCTATTGCTAAGGGTTTAGTCGCTTACCACCAAAAGTACGTTGACGAACAA
TCCAAGAACGAATTGAAGAAGGCCTTCACCTCTTACGACAGAACTTTGTTGATCGCTGAT
TCTAGAAGACCAGAACCAAAGAAATTCGGTGGTAAGGGTGCTCGTTCTAGATTCCAAAAA
TCTTACCGTTAA
Promoter Sequence
Download FASTA
>RPS16B YDL083C
ATATAATTCAATTGGTAGATCCCATTTTAAAAATTGTTAGTATACAGAAAAGTGGACGTT
TCAATTAGACACCAAATTTATCATATTATCTAAGAAGACTCTAACAATGAGTTCAGCAAA
TAGTGGTACAAAGGTCCTGTCTCGAATTTGCTTGGCCATTACTATGACTGCTCAGTTATT
GTAAAAAGGAGAAAAATCTCATGATTTATTAGAAAATAACTTTAGCCTCTCTAGGTTCAT
CAATAACGTGTGTTGTATTATGCATGCCTTTGTGCACTAGTATAATCCTCTAAGGTAACA
AGCGAGCTTCTTTGGTCTATGAAATGACAAAAGTGATTTGAATTATTTTATAGTAGACAT
ACCCATTGTGTACGATTCCTGCTGTGCTGTACTATGCTTTTCTCAAACCCCTTCGAACAG
AATGCTGCAAGCTTAAATGGATTAGTAGCTAATATCCGATCATTTCAAATTTTCCAAGAT
TTCCACACCTCTACTGTGATTATTCCGACTAGAAAAAAATTAAATTTTCTAACTACAAAA
AATTGCCTGCATATATGTAAGGATGTAACAGGAAATGTATGGGTCACATATTAATAGCTT
GTTTTACTCCATAAAAGAGTCTGATATTCAGAAAAAACACCCATACATGTTGAAAAATAA
TGCATTGTGAAAAAAAGTGGTTGAAAAATGTATGCGATCTAGGAAAAACTGAATTTTCCT
TAGGTTGTCGCTCCTCCTCTAGAAGGATGCTGTGGCCTTTGACCTGGGCGGAAATTCTCT
CTGTTTCCCTCTAGCTGAGGGAAACAGAACTGGTAGCAGTTCGTTCCGGCCAGGCCGCGT
GAGCCTATACCACCGAATATTATCCTAGCGCAGAGAGTAACACTGGCAAAGTCAAAAGTA
AATGCCATGTAAAATGTATAGGTTACGCAGTAGACTATTTAATATATACCTTTTTATTTA
GCAGTGTTTCGAAAAATACAGCAAGAGAATAAGCAACAAG
Chr coordinates Chr IV from 307333-306926,307789-307766
w3c xhtml validator w3c css validator