Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HNT1
Systematic Name YDL125C
Strain S288c
Description Adenosine 5'-monophosphoramidase; interacts physically and genetically with Kin28p, a CDK and TFIIK subunit, and genetically with CAK1; member of histidine triad (HIT) superfamily of nucleotide-binding proteins; protein abundance increases in response to DNA replication stress; human homolog HINT1 can complement yeast hnt1 mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>HNT1 YDL125C
ATGGAGCCATTGATATCGGCACCGTACCTAACAACAACAAAAATGTCTGCTCCTGCTACG
CTTGATGCTGCCTGTATTTTTTGCAAGATTATTAAAAGCGAAATTCCATCCTTCAAATTG
ATTGAAACAAAGTACTCGTATGCTTTCTTGGACATCCAACCTACTGCTGAAGGTCATGCT
TTAATCATTCCTAAGTACCATGGTGCGAAGTTGCATGACATCCCGGACGAATTCCTTACC
GATGCTATGCCGATTGCCAAGAGACTGGCCAAGGCAATGAAGTTGGACACTTATAATGTG
TTGCAGAATAATGGTAAAATTGCGCATCAAGAAGTCGACCACGTCCACTTCCATTTGATT
CCTAAGAGAGATGAGAAAAGTGGTTTGATTGTAGGGTGGCCAGCCCAAGAAACGGACTTC
GATAAGTTGGGCAAGCTACACAAGGAATTGCTTGCCAAACTAGAAGGCTCCGATTAG
Promoter Sequence
Download FASTA
>HNT1 YDL125C
GACATAGTCAGTGCCCATCTTCTTCAAAGCTAAATCTAGTCCATCCGCTGGGGAATCTGA
CATCTTGATTTGAGGTGAGTACTTGTCTGTCAAGAATATTGCATTTCTTGGTTTTTCGGT
GAGGCTAAGTGCCTTCCCAACTTCTGGATATGTTCTGTAGATCTCAGCAGCATCAATGTG
AATAATGCCAGGTAACTTCAGAGCATAAACAATCTGTTCGACCAAACTGTTCGAAAAGGT
AGCATCCGTTTCTTCGTTTTTATACCATCTAGTACCTGTCCCAATGATGGCGATTGCGGG
GATTTTATTTCCATTATTCAAGGTAAAGAACTGTTGGTGAAATGACATCTGTAAAAGTGT
TGTTAACTGACCTCCGTTTCTTTAGGGTAACACAACCGTTTACATGTGTATCCATATCCA
CGTAGTATCCGACTATCAATATATCCGTATATATATATATATATATATGGGATGAGCGTA
TGTGAGTGTTTTCGTAGATATTCAAAATACGAGTAAAGGAGATCCTAGGTGTGGATTAGT
AAGGGGAGTGTGGCAACTTCCTTTTTCCGGTTAATTCTCCGCGCTTTCGTTAGACTATTT
TGCAAGGACCCAAATAGGAGACGCATGGAGGCTTCTACAAAACAGCGTGCCGTTTTGATG
GCATGAGCAGGGGGCGCAAAGGAAACACCGGTAAATCGCGCAAGACCTTGTTGGCCACGT
AGCCTCAAAGGTTGAATTGACACTTGTCTACAGAACTTGAAAAGTACAAAAGGAGGTCAC
ATAAAACAGTAAGCTTGAGAAGCTTTAAGATATGGTGCGAATCGTTACAGAATATTCCTT
GCAGAAATAATGGCGGGTCCGTTCTCTTCTGAAGAAGTTACCGCCCTACTGAAGCATTGC
TGTACGATCGTGTAATGTGATGTGTGTTCGACTGGAAAGCGGAGAACATTATGAAGTAAA
AGGACAATCAGCACGCCTTCCAGACTTTTAAGAAACATTG
Chr coordinates Chr IV from 239398-239019,239606-239510
w3c xhtml validator w3c css validator