Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL41B
Systematic Name YDL133C-A
Alias eL41, L41B, L41e, L47B, RPL47B, YDL134C-A, YL41
Strain S288c
Description Ribosomal protein L47 of the large (60S) ribosomal subunit, identical to Rpl41Ap and has similarity to rat L41 ribosomal protein; comprised of only 25 amino acids; rpl41a rpl41b double null mutant is viable
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>RPL41B YDL133C-A
ATGAGAGCTAAGTGGAGAAAGAAGAGAACTAGAAGACTTAAGAGAAAGAGACGGAAGGTG
AGAGCCAGATCCAAATAA
Promoter Sequence
Download FASTA
>RPL41B YDL133C-A
ACAGCCGATGGTAGATGCAAACTGGCCCCATTTAAACTCTTTTGGAAGATTTTTATCATC
GGTAACATTTCCATCAACGGTGCCCTTATCCTGAAGTCTTAATTTATCAAACTGCGCCTC
TAAAACATAAGGCGGCACTGTGGTAGGCACAAACGTGTAAGTATTTAATTTTGGATAGTC
TAGTGGTGAACCATCACTGTGTTTGGGAACATGTATCTTTGCATTCTGTAATGCTTCCAG
TGAACCTGACTTCCTTACTGTTTGATTTTTTTCAAGATCCACGTTTAAATTAAGTTGATT
TTGATCTGCGATTCTAGAAGCGTTCGTGGATGTTGTATCAGAATACGCTTCTTGGCTGGA
ATTAGAATCCCCCATTAAATTTGTCAGTGTAAAAAAAAAGAACGCCTCAAAAAATGCAAA
AAAATATCATTCACTTTCCCTTCTCAGCAATCTCACGGTTTCGAAATAGCAATCAAAGTA
TTTTTATAATTGACTAAACAAAAGGTGGTTGGAGACTTTGTGTTGTAGCTTAGAATTTCT
TCCACTATATGAAAGCCAAGACCTCTTCTCCTCTTTCGACACTTCGTTTATTTCCACTTT
CCCTTATTTAGTATTCATCGTTCAGAATGCTTTCTTTATTTCACGACGGTTACCACACCC
GTACACCCTTATCTCATTTCACCAGTACCTTTCCTTATTAGATTCATCTTATTTTATTTT
AGGATTTTTAGGTCATTGTACGACGCGTGTCGCACCATGGAAAAGGTGTCGCAGCTGCGA
TGCTATCCATTTACCCGTCATCATTGCTGGCAGAAATCCCATCTTCCTCTGCTGGGGTGA
TTTATATATATGGAGAGTTAACGAATGTAATATTTCTGAATGTTAAATAATTGTTATCCG
TCATTATTGTTTCACTTCTCTCTTTGAAATTTCGCTTGTTTTCTGTTTTCATCTTATATT
TTACTTCAATCCTAAGATAGTCATATCGACTTAATTCCAA
Chr coordinates Chr IV from 221801-221724
w3c xhtml validator w3c css validator