Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG9
Systematic Name YDL149W
Alias APG9, AUT9, CVT6, CVT7
Strain S288c
Description Transmembrane protein involved in forming Cvt and autophagic vesicles; cycles between the phagophore assembly site (PAS) and other cytosolic punctate structures, not found in autophagosomes; may be involved in membrane delivery to the PAS
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ATG9 YDL149W
ATGGAGAGAGATGAATACCAGTTACCCAACTCTCATGGGAAGAATACTTTCTTATCGCGA
ATATTTGGTTTACAATCGGATGAAGTTAATCCTTCTCTTAATAGCCAGGAGATGAGCAAC
TTCCCTTTACCAGACATAGAGAGAGGCTCATCTTTATTGCATTCTACTAACGACAGCCGC
GAAGATGTAGATGAGAATGACTTACGTGTTCCTGAGTCTGACCAAGGCACTAGTACAGAA
GAAGAGGATGAAGTAGATGAAGAGCAAGTCCAGGCGTATGCTCCACAGATTAGTGATGGA
TTGGATGGAGACCACCAGCTAAATTCTGTAACGAGCAAAGAAAATGTACTTGAAACGGAA
AAAAGCAATTTAGAAAGACTGGTTGAAGGCTCTACCGATGATTCTGTGCCCAAAGTCGGA
CAGCTTTCGTCAGAAGAAGAAGAGGATAATGAGTTCATAAATAATGATGGATTTGATGAC
GATACGCCCCTTTTTCAAAAAAGCAAGATTCATGAATTTAGCTCTAAGAAAAGCAATACT
ATAGAGGACGGTAAACGACCTTTGTTTTTCAGGCATATCTTACAGAATAACCGCCCTCAA
CGTGATACCCAAAAGCTATTTACTTCGTCGAACGCCATTCACCATGATAAGGACAAGAGT
GCAAATAATGGTCCCCGTAACATTAATGGTAATCAAAAGCATGGCACTAAATACTTTGGT
AGTGCTACACAACCTCGGTTTACCGGTTCGCCCTTAAATAATACAAACAGGTTCACTAAA
TTGTTTCCATTAAGAAAGCCAAATTTACTGAGCAATATATCCGTTTTAAACAATACCCCG
GAAGATAGAATCAATACGTTGAGCGTGAAAGAGCGGGCTCTGTGGAAATGGGCAAACGTA
GAAAACCTCGATATATTTCTTCAAGATGTTTACAATTATTATCTGGGAAATGGGTTCTAT
TGCATCATACTGGAAAAAATATTGAATATATGCACTTTGCTTTTTGTTGTTTTTGTTTCT
ACATATATGGGTCACTGTGTTGACTACTCCAAATTACCGACTAGTCACCGGGTTTCGGAT
ATTATTATCGACAAGTGTTATTCTAATAGTATAACGGGGTTCACAAAGTTTTTCCTTTGG
ATGTTTTATTTCTTCGTGATTCTCAAAATTGTTCAACTCTACTTTGATGTTCAAAAATTA
TCAGAATTACAAAACTTTTACAAGTATCTTTTAAATATATCGGATGACGAACTTCAAACT
TTGCCCTGGCAAAATGTGATACAGCAGCTAATGTACTTGAAGGATCAAAACGCTATGACG
GCAAATGTTGTGGAAGTCAAAGCCAAGAATAGAATCGACGCGCATGACGTTGCCAATAGA
ATCATGAGAAGAGAAAACTATCTCATAGCACTTTACAATAGCGACATCCTGAATTTATCC
TTGCCTATTCCATTATTTAGGACCAACGTTCTGACAAAAACACTAGAATGGAATATTAAT
TTATGCGTCATGGGCTTTGTGTTCAACGAGTCCGGATTTATTAAACAAAGTATTTTAAAA
CCTTCTCAAAGAGAATTCACGAGAGAAGAATTACAAAAAAGATTCATGCTGGCAGGATTT
CTTAATATTATATTGGCACCATTTCTGGTCACATACTTTGTTTTGCTTTATTTTTTCAGA
TATTTTAATGAGTATAAAACTTCTCCTGGATCTATTGGTGCTCGTCAATACACACCAATT
GCTGAATGGAAATTCCGTGAGTACAATGAACTTTACCATATTTTTAAGAAAAGAATAAGT
TTGAGCACAACCTTAGCTAACAAGTATGTTGATCAGTTCCCGAAGGAAAAGACCAATTTG
TTTCTGAAATTTGTTTCCTTTATTTGTGGATCATTTGTGGCCATTTTAGCTTTTCTCACT
GTATTCGATCCAGAAAACTTTTTAAACTTTGAAATCACCTCGGACAGATCTGTCATTTTC
TACATTACTATTCTGGGTGCTATATGGTCTGTAAGTAGAAATACAATAACCCAGGAGTAC
CATGTTTTCGACCCCGAAGAGACGCTCAAGGAGTTGTATGAATATACACACTATCTACCA
AAGGAATGGGAAGGAAGATATCACAAAGAGGAAATCAAACTAGAGTTCTGTAAATTGTAC
AACTTGAGAATAGTAATACTTTTGAGGGAACTCACTAGCCTGATGATAACACCGTTTGTA
CTTTGGTTTTCGTTGCCCTCGTCAGCCGGCAGGATTGTAGATTTCTTCAGAGAGAATTCT
GAATATGTGGACGGATTAGGTTACGTTTGCAAGTATGCTATGTTTAACATGAAAAACATA
GACGGTGAAGATACACACAGCATGGATGAAGACAGTTTAACGAAAAAGATTGCCGTGAAC
GGAAGTCATACACTCAACAGTAAACGAAGGAGTAAATTTACCGCCGAAGACCATAGCGAT
AAAGATTTGGCAAATAATAAAATGTTACAATCATATGTATATTTTATGGATGATTATTCC
AACAGTGAAAACTTAACAGGGAAGTACCAATTGCCTGCAAAAAAAGGCTATCCGAATAAT
GAAGGCGATTCATTTCTCAACAATAAGTATTCTTGGAGAAAGCAATTTCAGCCAGGTCAA
AAGCCGGAGCTATTTAGAATAGGTAAGCATGCTCTCGGCCCTGGCCATAATATTTCCCCT
GCTATATATTCTACAAGGAATCCCGGCAAGAACTGGGATAACAATAATAATGGTGATGAC
ATTAAGAACGGGACCAATAATGCTACAGCTAAAAATGATGACAATAATGGCAATAATGAT
CATGAATACGTACTAACAGAGTCTTTCCTTGATTCGGGCGCATTCCCTAATCATGATGTA
ATAGACCATAATAAAATGCTAAACTCAAATTACAATGGTAATGGCATACTCAATAAGGGT
GGTGTCTTAGGACTTGTTAAAGAGTATTACAAGAAGTCTGACGTCGGAAGATAA
Promoter Sequence
Download FASTA
>ATG9 YDL149W
CGGATTGAACAGTTATTCCCTGTGAGACCTGTCCGCGTAAGACACGAAGACGTTGAAACT
GTCAAAAGAGAAATACAAGAAGCTCTTTCAGAAAAGCCAACTCGTGAACCAACCCCCAGT
GTGAAGACAGAGCCTGTCGGAACCGGATTACAATCTTATTTGGAAGAAAGAGAAAGGCAA
GTCAATGAGAAACTGGCAGATCTTGGACTTGAAAAGGAGTTTCAATCGGTTGATGGGAAA
GAAGCGGCCGCTGAGTTGGAATTATTAAATGCAGATCATCAGCATATATTACGAAAACTA
AAGAAAATGAATAATAAACCAGAAAGATTCATGGTATTCCAGTTACCTACTAGGTTACCA
GCTTTTGAAAGACCCGCTGTGAAAGAAGAAAAAGAAGACATGGAAACCCAGGCTAGCGAC
CCTTCAAAGAAGAAGAAGAATATTAAAAAGAAGGACACGAAGGATGCTTTGTCTACTAGA
GAACTTGCCGGCAAGGTTGGGTCTATACGGGTTCACAAATCTGGAAAACTTTCCGTGAAA
ATTGGAAATGTGGTGATGGATATTGGCAAAGGTGCCGAAACCACATTTTTACAAGATGTT
ATAGCATTAAGTATCGCTGATGATGCATCCTCAGCGGAACTTCTAGGCCGTGTGGACGGT
AAAATAGTAGTCACACCTCAAATCTAATCGCACTCGCATCTGTCGAGTATATAAATGAAT
ATACACAGTCATAAATACTTCTAGAACAAATTACACTAATTAAGATGCTTAGATTCCCAT
TCAAAAGGTACTATTGACGTCTTGTCTTCTACAATTTCTCATCCTCTTTGAACATTGGTA
ATGTTATTCTAGTTATTGTTACCCAGTTTCGGAACTTTAGGGGAGCCACACTTTAAACAA
AAAGAAGCGCCATAACCACCGTGAAGTAATGAGTATCTCACTTTGATAAGAAGACATTTA
AGAACAGCCTGAAATATCAAAATCACGGAATTATTAGGTT
Chr coordinates Chr IV from 184925-187918
w3c xhtml validator w3c css validator