Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GGC1
Systematic Name YDL198C
Alias SHM1, YHM1
Strain S288c
Description Mitochondrial GTP/GDP transporter, essential for mitochondrial genome maintenance; has a role in mitochondrial iron transport; member of the mitochondrial carrier family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GGC1 YDL198C
AGGATTTGTTCGCTATCCAGGAACAGGAATTGCAAGATCTAAGGTTGCATAAGAAAATGG
CCGATGAGAGGAGCCGAACTACCCACTTGCATTTAGAAAGAAAAAATAATACCATCAAGC
TACTGCAGAGTTACGTGCAATCATTAATTCAACGGCTACCACCAGCCCAGCGCAAACACC
ATTTGGGCATATTCCAAAAACTTGGTAGCGAAAAATCGTGTCCACTCGCCCCCGCTGTGG
CAAGTACATATGCGCCTCTTCTACTCTTATCCCAGCATTCGAACCATCAAGAAATTGACA
ACACCCCTCAACGGCTTCTATTAGCGGCTCCAGACGGGCAGTCATATTCCGAAAAGAGCA
CAACACTAAACCTTGATTACTCATCAAGGAAATCCTACTTATCAAGACTACAACCACCAC
ATATAGCCAACCTGAAGTCTTTGACTCTGAAAACTCTGCCAAGGGTGCCCACGGACAGTC
CTCAACTTCCTTCAAAAGACAAATCTCAAGAGACTGCAAAGAAAGACGATCGGCCAAAAT
TGGTGGCAAATGAACCAGTCACACTAGACACATCAACTCCTCCTGTGGCACAAAGCTTGG
CGGATTCAAAGCATTGTTCAGGACTACATAAATAAATATAAATACGAAGCGGTAGAGATC
ACTACGGCATCCGCCTATCTGCAAAGGAAGCTCTATCGCAAACATACCACCGTTAATCTT
CGCTGCCACAGTTTCCTTGTAGACCAATGGCATGTAGCACCGCCGCCACTGCCCGAAAAA
AAAAGAAAATGAAAATTAAAGAACGATCGCAATTCTTGATAAAGCTCGAGAAAACAAAAA
CTCGTGAGTCACTGTGCATTTGCTGTCACATTTTCTACAAAGCGACGACATAGATATATA
GAGGTGACTATATAAATCGTGTATCTCTTTTGATGGTTAATATTTAGCCTTTAGACATAT
ATCAAACAAAGCATCTTCCAAAGTATTAGAAAAGGGAAAT
Chr coordinates Chr IV from 104551-103649
w3c xhtml validator w3c css validator