Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MGT1
Systematic Name YDL200C
Alias MGMT
Strain S288c
Description DNA repair methyltransferase (6-O-methylguanine-DNA methylase) involved in protection against DNA alkylation damage
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>MGT1 YDL200C
ATGAAGGAACTGCTTTACTATACATTCATTGAAACTGAAGTGACTGGTGCATTTTTGGTG
TTTAGGGAAAAGACTCAAAACCTTGTTTTTGCCTCGTTAGGTAATGATAAGCTTTTTTTA
TTGGGAAAGGTGGAAGGCTTCTTGAAGAAACATGAGAAACAGGATACAATGTACGATTTA
CAGGAACTAAAAGAGGCAGAAACATATAAGAAATCAATCGAAAATTATACAATATGTTTA
GAAAACAAAATGCCATTACCATCGGGCGCTATTCCCTTTGAGTTCCTGTTTGGAACAGAT
TTTCAACGTAAAGTTTGGAATGAGCTTTTAAACGTGGAACACGGCCACGTCGTAACATAT
GGTGATATTGCAAAGAGAATAGGGAAGCCAACTGCCGCAAGATCTGTCGGAAGAGCTTGC
GGCTCAAATAACCTGGCATTGTTAGTACCTTGCCATAGAATCGTTGGTAGCAATAGAAAA
TTAACCGGATATAAATGGAGCTGTAAACTGAAAGAACAGTTATTAAATAATGAAAAGGAA
AATAGCTTAAGCCTTAGTAGATTGTAG
Promoter Sequence
Download FASTA
>MGT1 YDL200C
GGTGTTACGGAAACGTAAAGAGAAAACGAATGTACTCTTAGGTTCGATTGTGATGTGTGC
ATTGCTATTTACCATATCTTTTACAGACTGGTTTCCCAAGAGCACAACGAGGTATATATC
AATACTATTTGCTGTTTTTCTTTTTACGCACTTCATCAGTTGGGATTCTATAGGATGGGT
TATGACCATTGAGCTTCTACCTCACTTGTCACAGGCCCCAGTGATACTACTAGTCTCAAA
CTTTTATTGGATTTTTAAGTGGTTCGTCAGCTTAATAACCCCTATACTTATTGACCGTCT
GTCTTGGAAGTTTTATCTTATTCCATCTTTATCTTCCTTTATTTCCATTATATTTGTGCT
GAAGATTTTTCCTATAGAAACCCGTGACGAAAGGTTAGATTCTGATGATGATTCTACCGG
AAACGGTAGCGGTAACCATGATGATGTTTTTGACGATACCGGTTCTGAATTCTCCTCCTC
ACCATCTTTTTCCGCGTATCAGATAAACACTCTAGGAAGTAGTATCAAACAAAATAATCA
AGCCTATTCATCTATTCAAAATGAGCAGATTCTACCCAAAAACGGAAACTTATCGAACCA
GACACACGGTTCTGCACAAAATGTTTATTTCATTACATCTGATTCAGGACCATCAAGGAC
TGGAGAATTTTTCAGTTTTCATAACAGAACCGATCCAAATATCAGCGACAACATTGCTGC
GAATAAACCCAGTTCAGGTGGAGGCCAGAATTCGCCTGGAGACATGGCAGTTGCCTAGTA
TGGCCTCATAAAAATATTTGCTTCATCCTAAGTATAAATGTTTAGTTTTATCCTACATAC
ATATTCTTATTATAGTCATTAGAAAAAAGGCACGGCGCTATTGGCCTGGCAGGGCATTTA
AAATGCGGTGGAAACAAGGAAGATTAATCAAGTAATGATATAGCATATGCACAAAAAAAA
AATTGAAAACGGTCGCATTTTTGATCTAAATGGACCAACG
Chr coordinates Chr IV from 101067-100501
w3c xhtml validator w3c css validator