Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDL206W
Systematic Name YDL206W
Strain S288c
Description Putative protein of unknown function; YDL206W is not an essential protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDL206W YDL206W
TAACTCAATTGATAAATGATACTAAAGGCGACTCTCTAGCATATCATTGGATTTTAAACT
TTATTGCCAAAGCCGTAGTACATCAGGCGGAAACAGAAGTCAGGGTAAAACCAGAGTCTG
CTCTGCCCCTAGGGAAATTGACTTTATATTTGTTAGTCCAATTCCCAGAGTTACAGGAAT
TGTTTATGGCAAGACTTGTCAAGAAATGCCCCTTTGTGATAGGATTCACGTGTGAGATTG
ACACAGAAAAAGGCCGTCAAAACATGGGATGGAAAAGAAACAACGAGAATAAATGGGAAG
ATAACACATCCTACGATGAGAGAATGGGCGGGATCTTATCATTATTTGCCATAATAACGA
GATTACAGTTACCTCAAGAATTTATCACCACCACGAGTCATCCTTTCCCCATCGCATTAT
CGTGGCATATTTTGGCTAGAATATGTAATACGCCACTAAATTTAATAACAAATACCCATT
TTGTCATACTCGGTTCGTGGTGGGATGCCGCTGCCGTACAGTTTCTTCAGGCGTATGGGA
ACCAAGCCTCTAAATTGCTAATCTTGATTGGTGAGGAATTGACCTCCAGAATGGCTGAAA
AGAAATATGTGGGTGCTGCGAGATTAAGAATTTTATTAGAGGCCTGGCAAAATAATAATA
TGGAGTCCTTTCCGGAAATGTCTCCTTAGAAAATTCTGAACTTATATATGCACATTATGC
TAATACACTTTATAATGACTTTATTTTAAACGTCGCCATTTTTAGTTTTATTTTCGGCTC
GATATCAAGGGATGGCAGAAAATACGTCATGAATATTAAGCCGTAAGTGGGAAAAGTTAA
GACAATCTCCCACTCAAATATACGTACGTGAAATTGACATTTGAACTACCGCTCATAATA
TCTTATTCGATCAAGCAGAATATTCATTCTTTTTCCGGCGCCTATCTCCTTACCTTTATT
TGTAAATGCTACTCTTCATTTATCAAATTTTTTAAAGCAG
Chr coordinates Chr IV from 90176-92464
w3c xhtml validator w3c css validator