Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UGA4
Systematic Name YDL210W
Strain S288c
Description Permease that serves as a gamma-aminobutyrate (GABA) transport protein involved in the utilization of GABA as a nitrogen source; catalyzes the transport of putrescine and delta-aminolevulinic acid (ALA); localized to the vacuolar membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA4 YDL210W
ATCTGTTCATTCCATTTTTCGTGTTGTATCTCAAGATGAGATAGCTTAGCGTTGCTACAT
ACATAAATCTAAACATATAAACACCTGTGTAACTCGTTAACGTCTGGGCTTCCATGCTTC
TACCATTTAGAATGATGTAGACCATTTATTCCAAGAGGATAAGCACCCTCTGTGATTCAA
AATGATAATAAGTGTTGACGACAAGTTACTCTCGCAGAATTGTTGTCAACAGTCTTGTAT
TAGTTGTTATCCAACGCTCCCGTTTTCAAGTTCACTTAGCGCAAGTGGTTTAGTGGTAAA
ATCCAACGTTGCCATCGTTGGGCCCCCGGTTCGATTCCGGGCTTGCGCAAGTTTAATTTT
TTTTCTTTTTCCACATTGTTTTCCACTTTGCACTCATTTCCAGTGTTTATTGTGAATGAC
AATTTCTTCAATCATTGAAATGATTGATTTTTTGGGATCTATTTTTCTCTTTAGTGGTTA
CTGATCAGGCAACTCTATATCATTGTTTAACCGCGGCTTGCGTATCTTATTTTCTTTTTC
CTAGGCATCTTACTAAGGTACTCTTATCGCTAATCGCTTATCGCTTATCGTGCGCCAAAA
ACCGCCGGCGGCAATTTCGAGATGTTTTATGTCATGTTGGATTTTGCAATCTATTACCAT
GGAGGTGAGGGCCTTCGATGGTCCAATACCGGTGCACGTACCCATGTACGTTTATCGAAT
AAGGGGAGAACCTACTAATTTTAAGTCGGATAACGCGGCTTGGCACAGTAATCAGTTCCT
TCTTTGGGTTAGAATCTTGATGTGAGATTGTGCTCAGTGATAATGATAGCGAATACGGCT
TACTCTTGAATAACAAATGCATATATATTAAGAAGTAGTTCAAACGTATTCTGTTGACTG
GCATGGTCCTTTCCTTCTTGTTGTGATTATATAAAACAGTATAAGCTGTTTACTTCAGTT
GTGAAGTGTAACAAGGTCTTATAATTTATTATTACTAACA
Chr coordinates Chr IV from 84270-85985
w3c xhtml validator w3c css validator