Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC13
Systematic Name YDL220C
Alias EST4
Strain S288c
Description Single stranded DNA-binding protein found at TG1-3 telomere G-tails; key roles in regulation of telomerase, telomere end protection, conventional telomere replication; regulates telomere replication through recruitment of specific sub-complexes, essential function is telomere capping; forms homodimer via N-terminus; disruption of dimerization leads to short telomeres; autophagy and proteasome are involved in Cdc13p degradation; differentially phosphorylated through cell cycle
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC13 YDL220C
ATTTACTTACTTTTATGTAAAGAATATAAAACAATTCTAGACTTTCTTGGCGAAGGTTAT
TGAAGGAAGCGTGAATTCAAAAATCCATCACAGATATTTTGTATTCATTTTTTTGGGGAG
GGCTCCTCTCCGCTCTACTCAACTTCACTGAGAACATAACATGGAAAGATTTTGGTACTT
TATCTTGCGAAAGAAAGATTGCAAATAATGTTTGCTTTTTATTTTCTTCTCGTATATATC
TATAAGGTCAATCTTATTGGTCACTGTCAAGAATGATTGTAACGGGCCCTTCATTAGTTA
AAGAGCAACTCATCATTGCGCCGAATTCACCATCCTTTACTTTTTCCTCACCCAAATCAC
TTCTTAGTAATTTTAAGAATTCTTCATAAAGTTCTTTAGCTATATGACCCTTTTGGGCCA
AATGGAAATCGGGTTTAGTTCCCTTCTTGGTTTTTGCCATCAAAGTGAATTGAGACACGG
ATAGAATTTCACCATTGGCCTCTTTAATATTCTTCTTCCATAGATTTCTGGATTCATCTT
CGAAGATTCTCAAACTAAGAACCTTTTTCGATAATTTATCTATCTCCGCCATAGAATCAT
CAATGGAAATACCTACTAGGAGCATATAACCATGTTTAATACTGTCACATAGATAGAGGT
GTTAGTAAAAAAAATTGGTGCACTAACGAAGCTGAAAAAACCGGTAACATACCTTGAAAT
AACTTTTGAATCGACGACTACAGATGCTTGGCTGACTTTTTGTAAGACAATCTTCATTGT
AAATCCGCTGCTGAATAATATGTGGATTATTTAATATGTACATGCAGCCTTGATTAACGT
GATTATACTTTTTAAACCTTTGATATCCAAATTTTTCAACGTCATAAGAGACGCGAAGGC
CTAGTGAGATGCGAAATGCTAATTCAAAATGGAAATTTAAGAATATATTCATATATGTTT
CTCTTTGGATACGAATGACCGTGGAAACTATCGCCTAAAA
Chr coordinates Chr IV from 65018-62244
w3c xhtml validator w3c css validator