Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FMP45
Systematic Name YDL222C
Strain S288c
Description Integral membrane protein localized to mitochondria (untagged protein); required for sporulation and maintaining sphingolipid content; has sequence similarity to SUR7 and YNL194C
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FMP45 YDL222C
GACTCCTCGGCTCGCCTCCCGCGCCCACAGCAAACACACAAGAGCAACACATTATACAGT
TGCGAGGGCCGTATCATCGCCATCGAGTACCACGCATCTGATCTCTGCTTCCATATCACG
AATGAGCTCCCACTTTTACAAACCCGCGGCTTGGCCCCGGAGCGAGTGTTGCAACTACAC
ATCATTACCTCCAAGAACTTTGCTTATTTTTTCAACCGCTCAAGCGCCTACTTACAGCGT
CAGCCTCTTGAGGAAAAATATACGCAATTGGCACAATTTCTCGGCCATTCATTTAAATTC
AATATAACCTCCTCGCTCACGCTGTTCCCTGACACTACCGTGGCACTCCAGATCTGGTGC
CCAATTGAATGCACCTTTCGGGAATTGCAACAACAGCTGGCCCATCCGAAGGTTGCAGCG
GCTCCTGATTCAGGGAGTCTTGATTGCGCAATTAATGCTACCGTCAATCCTCTGCGACTT
CTTGCCGCGCAAAATGGCGTCACCGTGAAAAAGGAGGAGGATAATGACGATGACGCCGGA
GCCGTTCCCACCTCGTAAGACATGATCCGCGCAGCCCAACGCGGCGGTGCCAAATTGCAG
TGACGTCTCGGAGTAATATAAAAAAAAAAGACCAAATAACCAAATTTAAGGGTGCTCTGA
ATATAAGGGAGTGGAACGTTTTCACACGAAGGAAAAGGGAAAGAGGGGAGTGGTAAGAAG
CAAGAGTCAATGAAAGGTCTTCCTTCCTTCTTGATGCTAAAACAAGGATAGTCTGGAATG
GGGAGGAGCATTCGGCGCAGATGCCGACATATAAAAGGATGGTTGCTTTGCAACAGTTAC
TTGATCTTGCTTTGTTCTCTTGATTAGTTATCCGTTAGATGCAAACTTTAAGTACAGTAA
TTTTGAAGTGAATTAAAAAGAAAGAGGTATTTACGTTTAACGCTTATACTTTCCTTTTTA
TCCAAGTAACAAGTAACACTAATCACTATAATCTACCGCT
Chr coordinates Chr IV from 61801-60872
w3c xhtml validator w3c css validator