Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THI13
Systematic Name YDL244W
Strain S288c
Description Protein involved in synthesis of the thiamine precursor hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THI13 YDL244W
ATTCTAAGTAACCAATTTCAAAACTGCATCTATCTTTGGATAAACTGGTGTGATAAGATA
TACATTGAATGCTGATGTCCATCACACATATGTTTACACTGGCGTCGCTCTGTACCTATT
TCAGAATAGATTAATGACAAAGTAAAAGTTCAATAGGCGGGCGGAAAAAATTAGAGATTC
ATTGAATCTCTAATTTATTTAAAGTTTATAAGTCGTTACATATTTTTCTATGGTAAGTTC
CTGGATGTTCTGGTACATCGAGCGTATTTAATATGTCCATTTGGCATGTCCTTTATATGC
CCATCTTGTATAAGGTAGTTTTAAATTCTAAGTTATTCAATACTACTGACTAATCATTGT
TAATAGCAATTTCGCAGTCATGTTGGGCTCAAAATACTATAGTCATTTTTGTGATTTTTT
TTTTTTATTATTTTGATTGAAGAAGGAACAATTCGAAATATGGAGAAAACGTAAAAAATG
TTAGAGTTATAATCGAAATTATCCTAGTTCAGATACTGAAACTTAGGCATAGGTGTAGTC
ACAAGGTATTTCCCTTTACATATATATTTGTATATGTGCATTCTCTTTCGGGCCAACTGG
GATATGCGATTAAGCGTTTTGCCGGCGTAATGTTTTAAGGGAATAAGATTGGCGCGTTAA
TGCATAAAGACAGCAATCACCTGGAGGTAACAGCGTTAATGCATTTATCGATTTTTGGCT
ATGATGCAATGAGCTCAATTCGAATTGGATGGCTTATGAACTATGAAATATACGAATTAT
TCAACTAGCAGAAGGCTTGAAATATTACTTATCCAGGTTATGTAAAATGGTGCTGTTATA
GCAAAATAAGCAACATCAATCTCTTGTGACGACAGCAAACAAAACATATAAAAACCTCGT
ATTATCATCTTCATGAACAATATTCTTGTCCATTCTTTCGTTCTTTTACCTTTTCAATTA
TATAAAAATACCACAACAACAATACACATACTTCCAAGCT
Chr coordinates Chr IV from 16204-17226
w3c xhtml validator w3c css validator