Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAF1
Systematic Name YDR005C
Strain S288c
Description Negative regulator of RNA polymerase III; component of several signaling pathways that repress polymerase III transcription in response to changes in cellular environment; targets the initiation factor TFIIIB
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MAF1 YDR005C
AATGTCTATTGCTGTTCATCTTTGCAAAGTTATTGACGATCTTCACAGGGAGTACGACAA
CAATGGTAGTTGTGAACAAGCCAGAAGGCCTCAATTGCCTTCATTAGACAACTCAAAAAT
AACCTTTGCTAAATCTTGGTTATCTAAGCAAACTCAACCCCTCAGTGAAGTTTATGGTGT
CCTAGAAAATAGAGTATTCAAATCACTAGAGGACGCTATCTTCAACAGGTCCGAGTGCAC
AATTGATGGACGCGTTAAACAAGACTTTGTGTACCTCTACAACACAAACAATGGCAACGT
AGGTAGCACTAACACTTTGAGTACTACTACAGATACTGCTAGCGTTAAAATCAGCCCGTC
TTTGATGTCTCCTTCTAAAACCTCCACCACCACACCTACTGGCAATGCGATTGCATCCAG
AGGTTTATTCGCAGCAACAGAGCTGGAGGAATTCGAGAATGTTTATCGCCACTTATATGC
ATTAATCAACCTTCATTGGTCCGTATTCGGTCCTCATTATATCGAAATGTTAGGAGATAA
AGTTAATAAAAAAGGAATATAACTATTATCGGTAATGGAGGAAAAAAAAATTTTTTTACC
ATTTCTTTATGTAACTTCATATATCATTTTTAAAGCGTACATTTCTTATAATTTCACTTC
TTAAATGCAGTCACATATTTACTGCTATCAGACAAAGTAAAGCGTCGCTAATTACTTGCC
TCCACGAGTTGCTTGTCAATCAGGGGCGCTTCATCTCGCCAGCGAAAGCGCGTTGTCCAT
CTTATTTAACAAGAGAAAAAAAAGATAATTCAACTTAAAAAGAACGTGCTATCAGCTATA
TAAAATGTAGACACATTATGTATCAGTGTTTCTTTAGCAATGCGAAAAATATAGGCTTAG
TGTCATTTACTTAAAGTTTAGAAACTCTGCACACTTCACCAAGAACAAGTTTAACCGCTC
ATTACTCCAAACGGATTTTTTTGCCTAAAGAATCACGACA
Chr coordinates Chr IV from 458017-456836,458103-458098
w3c xhtml validator w3c css validator