Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAF1
Systematic Name YDR005C
Strain S288c
Description Highly conserved negative regulator of RNA polymerase III; involved in tRNA processing and stability; inhibits tRNA degradation via rapid tRNA decay (RTD) pathway; binds N-terminal domain of Rpc160p subunit of Pol III to prevent closed-complex formation; regulated by phosphorylation mediated by TORC1, protein kinase A, Sch9p, casein kinase 2; localizes to cytoplasm during vegetative growth and translocates to nucleus and nucleolus under stress conditions
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>MAF1 YDR005C
ATGAAATTTATTGATGAGCTAGATATAGAGAGAGTGAATCAAACTCTCAATTTCGAGACA
AATGACTGTAAAATCGTGGGCAGTTGCGATATTTTCACAACAAAGGCGGTTGCATCAGAT
AGAAAATTATATAAAACTATTGATCAGCATTTGGATACTATTTTACAGGAAAATGAGAAT
TACAATGCTACCCTTCAGCAACAGCTAGCTGCTCCCGAAACAAACCAATCACCCTGCTCG
TCGCCATTTTATTCTAATAGGAGGGATAGCAACTCTTTTTGGGAGCAAAAGAGAAGAATA
TCTTTTAGTGAATACAATAGCAATAATAACACTAACAACAGTAATGGCAATAGCAGTAAT
AACAATAACTATTCTGGACCTAATGGTTCTTCTCCAGCAACTTTTCCCAAAAGTGCCAAG
CTAAATGACCAAAATTTAAAAGAATTAGTCTCGAATTACGATTCTGGCTCTATGAGCTCA
TCGTCTCTTGATTCTTCTTCTAAGAATGATGAGAGGATAAGAAGAAGGAGCAGTAGCAGT
ATTAGCAGTTTCAAAAGTGGTAAATCATCGAACAATAATTACAGTTCTGGTACAGCAACC
AACAATGTTAACAAAAGAAGAAAATCTTCGATAAACGAAAGGCCAAGCAATTTAAGTTTG
GGTCCGTTTGGTCCCATAAACGAACCGTCAAGCCGCAAAATATTTGCTTATCTGATTGCT
ATCCTCAACGCTTCTTATCCTGACCATGATTTTTCATCGGTTGAGCCAACGGATTTTGTC
AAAACATCATTGAAAACTTTTATTTCCAAATTTGAAAACACCTTATATTCTCTTGGTAGA
CAACCAGAGGAATGGGTCTGGGAGGTAATTAATTCTCACATGACTCTTTCTGATTGCGTC
CTTTTTCAATATTCACCTTCAAACTCTTTTTTGGAAGATGAGCCTGGCTATCTTTGGAAT
CTTATAGGTTTTCTTTACAACAGGAAAAGGAAAAGAGTGGCTTACCTTTACTTGATTTGC
TCGCGTCTAAATTCGAGTACAGGCGAAGTGGAAGATGCCTTGGCAAAAAAACCTCAGGGA
AAGCTTATAATAGATGATGGCTCAAATGAATACGAAGGAGAATACGATTTCACTTATGAT
GAGAATGTAATAGATGATAAATCAGATCAAGAAGAATCCCTACAGTAG
Promoter Sequence
Download FASTA
>MAF1 YDR005C
AATGTCTATTGCTGTTCATCTTTGCAAAGTTATTGACGATCTTCACAGGGAGTACGACAA
CAATGGTAGTTGTGAACAAGCCAGAAGGCCTCAATTGCCTTCATTAGACAACTCAAAAAT
AACCTTTGCTAAATCTTGGTTATCTAAGCAAACTCAACCCCTCAGTGAAGTTTATGGTGT
CCTAGAAAATAGAGTATTCAAATCACTAGAGGACGCTATCTTCAACAGGTCCGAGTGCAC
AATTGATGGACGCGTTAAACAAGACTTTGTGTACCTCTACAACACAAACAATGGCAACGT
AGGTAGCACTAACACTTTGAGTACTACTACAGATACTGCTAGCGTTAAAATCAGCCCGTC
TTTGATGTCTCCTTCTAAAACCTCCACCACCACACCTACTGGCAATGCGATTGCATCCAG
AGGTTTATTCGCAGCAACAGAGCTGGAGGAATTCGAGAATGTTTATCGCCACTTATATGC
ATTAATCAACCTTCATTGGTCCGTATTCGGTCCTCATTATATCGAAATGTTAGGAGATAA
AGTTAATAAAAAAGGAATATAACTATTATCGGTAATGGAGGAAAAAAAAATTTTTTTACC
ATTTCTTTATGTAACTTCATATATCATTTTTAAAGCGTACATTTCTTATAATTTCACTTC
TTAAATGCAGTCACATATTTACTGCTATCAGACAAAGTAAAGCGTCGCTAATTACTTGCC
TCCACGAGTTGCTTGTCAATCAGGGGCGCTTCATCTCGCCAGCGAAAGCGCGTTGTCCAT
CTTATTTAACAAGAGAAAAAAAAGATAATTCAACTTAAAAAGAACGTGCTATCAGCTATA
TAAAATGTAGACACATTATGTATCAGTGTTTCTTTAGCAATGCGAAAAATATAGGCTTAG
TGTCATTTACTTAAAGTTTAGAAACTCTGCACACTTCACCAAGAACAAGTTTAACCGCTC
ATTACTCCAAACGGATTTTTTTGCCTAAAGAATCACGACA
Chr coordinates Chr IV from 458017-456836,458103-458098
w3c xhtml validator w3c css validator