Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GRX3
Systematic Name YDR098C
Strain S288c
Description Glutathione-dependent oxidoreductase; hydroperoxide and superoxide-radical responsive monothiol glutaredoxin subfamily member with Grx4p and Grx5p; redundantly protects cells from oxidative damage along with GRX4 and GRX5; with Grx4p, promotes the dissociation of Aft1p from iron regulon gene promoters and subsequent nuclear export in iron-replete conditions, regulating iron homeostasis; involved with Grx4p in the deglutathionylation of Sir2p, restoring deacetylase activity after disulfide stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GRX3 YDR098C
CATTGCTGATGTGATGACAAAACCTCTTCCGATAAAAACATTTAAACTATTAACAAACAA
ATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGGAATAAAAATCAACTATCAT
CTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTTAGAAGATGACGCA
AATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAA
TAGGATCAATGAATATTAACATATAAAACGATGATAATAATATTTATAGAATTGTGTAGA
ATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAGAACTTCTAGTATATTCTGT
ATACCTAATATTATAGCCTTTATCAACAATGGAATCCCAACAATTATCTAATTACCCACA
TATATCTCAATAACAAAACGAACAACATGAGATAAAACACGGCCTTCCCTAGCTGAACTA
CCCAAACGTATAAATGCTTGAACAATTAGTTTAGATCCGAGATTCCGCGCTTCCACCACT
TAGTATGATTCATATTTTATATAATATATAAGATAAGTGACATTCCGTGAATTAATCTGA
TAAACTGTTTTGACAACTGGTTACTTCCCTAAGACTGTTTATATTAGGATTGTCAAGACA
CTGCGGTATTACTCGAGCCCGTAATACAACAATACACAGTTGTTACGGTCCTATAGTGTA
GTGGTTATCACTTTCGGTTTTGATCCGGACAACCCCGGTTCGAATCCGGGTAGGACCTTT
TTTAACTGTGGCTTCTCTGTTGAACCATCAGTTACTTTTTTTTTTTTTCAGAGAATGTGT
GCCGGGTCATGAGATGCCAAACTAAGAGGTCATTAAAATATATTTCAAAGACTAAATGTG
TTCTTTTCAGGTTCCATCTGCATTTTCTTTTAACTACACCTCGTACTGTTATAAACGCCA
CCAAGCAAGATATTACACAGCAGCAAAACTTTTTCAGGAA
Chr coordinates Chr IV from 644930-644178
w3c xhtml validator w3c css validator