Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VBA4
Systematic Name YDR119W
Strain S288c
Description Protein of unknown function with proposed role as a basic amino acid permease based on phylogeny; GFP-fusion protein localizes to vacuolar membrane; physical interaction with Atg27p suggests a possible role in autophagy; non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VBA4 YDR119W
ACGTGAAACTTTATAGAGACCTAATTAACAGCATGTCTGATATGGAAAAAGATATTGCAC
AAAGTAATGTTAATTCTCATATTCAACAGCATATTCTGGTTGATTTAAAAACGGATGTTT
TTGCGCAAAAATATCCATCTTCGCAAATAAATTTGCTTGATGCCATAAAATTACCAAAGC
ATAATTACATAGTCTACCTTATTCAGGTAACAAAACACAACAGTGCTCAAGAACCTTTCT
CAGAAGAAAACAAAAAGAAACTATATATAGGTACTCTGAAAGATGAGAATTTAGGCATTA
TATCAAAGGAATCGTCAGTCAAGATTCCGGCGCTATTCAAGAGCTATAGGTTGAGCAGTA
CAAGGTTTGTGCCGAATAGGGTCCATAGCTTGCTTCGGGATATTGGATTGTCAGATAGTA
ACTATCATAGTAGCCACGTCACCGATTATAGGGGAGAAAACTATGAAAACGAGGAAGATG
ATGGCACAATAGCTATTCCTGCTTACATCAGGGAGAATAGGGAAAATGATGATTTCATAG
CATGCACCGCGAAGGTATCGGTGGATGGAAGAAGCGCATCCCTAGTGTTTCCAAAAGAAA
AACAAAATGTTTGACACATAGACAGATGACGAGTAGCTTTTTTTTAGTATTTGCATAATG
ATCACCAATAATAGTAGTAATGAAATGTAAGCGTAAATAGCGTATGCATCATCTCCCAAG
ACTTTTCTTTTGTATGGCGCACTATGAAGAAGTTTGGAACCCGCCTGTGGTGTACTGAGA
AAAAAAAAAAATTTCAAGGGCCCGCAATCTCAAAATGGAGTCAATTGTGTCAAGTCTTTT
TTTTTTTTTTCATCGTTATCTCACTTTTTATTGCTTATCTTAAGATAATTTAGCTGATAT
ACTATATAGAATAGCCGAAGTGTCAGTTTACTCAGATTTTTGCTACTTTTGATTACTTTT
TTTTTACATTTTCAAGGTAATTGACGTCGGTTAAGTAGAG
Chr coordinates Chr IV from 688227-690533
w3c xhtml validator w3c css validator