Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO1
Systematic Name YDR127W
Strain S288c
Description Pentafunctional arom protein, catalyzes steps 2 through 6 in the biosynthesis of chorismate, which is a precursor to aromatic amino acids
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ARO1 YDR127W
ATGGTGCAGTTAGCCAAAGTCCCAATTCTAGGAAATGATATTATCCACGTTGGGTATAAC
ATTCATGACCATTTGGTTGAAACCATAATTAAACATTGTCCTTCTTCGACATACGTTATT
TGCAATGATACGAACTTGAGTAAAGTTCCATACTACCAGCAATTAGTCCTGGAATTCAAG
GCTTCTTTGCCAGAAGGCTCTCGTTTACTTACTTATGTTGTTAAACCAGGTGAGACAAGT
AAAAGTAGAGAAACCAAAGCGCAGCTAGAAGATTATCTTTTAGTGGAAGGATGTACTCGT
GATACGGTTATGGTAGCGATCGGTGGTGGTGTTATTGGTGACATGATTGGGTTCGTTGCA
TCTACATTTATGAGAGGTGTTCGTGTTGTCCAAGTACCAACATCCTTATTGGCAATGGTC
GATTCCTCCATTGGTGGTAAAACTGCTATTGACACTCCTCTAGGTAAAAACTTTATTGGT
GCATTTTGGCAACCAAAATTTGTCCTTGTAGATATTAAATGGCTAGAAACGTTAGCCAAG
AGAGAGTTTATCAATGGGATGGCAGAAGTTATCAAGACTGCTTGTATTTGGAACGCTGAC
GAATTTACTAGATTAGAATCAAACGCTTCGTTGTTCTTAAATGTTGTTAATGGGGCAAAA
AATGTCAAGGTTACCAATCAATTGACAAACGAGATTGACGAGATATCGAATACAGATATT
GAAGCTATGTTGGATCATACATATAAGTTAGTTCTTGAGAGTATTAAGGTCAAAGCGGAA
GTTGTCTCTTCGGATGAACGTGAATCCAGTCTAAGAAACCTTTTGAACTTCGGACATTCT
ATTGGTCATGCTTATGAAGCTATACTAACCCCACAAGCATTACATGGTGAATGTGTGTCC
ATTGGTATGGTTAAAGAGGCGGAATTATCCCGTTATTTCGGTATTCTCTCCCCTACCCAA
GTTGCACGTCTATCCAAGATTTTGGTTGCCTACGGGTTGCCTGTTTCGCCTGATGAGAAA
TGGTTTAAAGAGCTAACCTTACATAAGAAAACACCATTGGATATCTTATTGAAGAAAATG
AGTATTGACAAGAAAAACGAGGGTTCCAAAAAGAAGGTGGTCATTTTAGAAAGTATTGGT
AAGTGCTATGGTGACTCCGCTCAATTTGTTAGCGATGAAGACCTGAGATTTATTCTAACA
GATGAAACCCTCGTTTACCCCTTCAAGGACATCCCTGCTGATCAACAGAAAGTTGTTATC
CCCCCTGGTTCTAAGTCCATCTCCAATCGTGCTTTAATTCTTGCTGCCCTCGGTGAAGGT
CAATGTAAAATCAAGAACTTATTACATTCTGATGATACTAAACATATGTTAACCGCTGTT
CATGAATTGAAAGGTGCTACGATATCATGGGAAGATAATGGTGAGACGGTAGTGGTGGAA
GGACATGGTGGTTCCACATTGTCAGCTTGTGCTGACCCCTTATATCTAGGTAATGCAGGT
ACTGCATCTAGATTTTTGACTTCCTTGGCTGCCTTGGTCAATTCTACTTCAAGCCAAAAG
TATATCGTTTTAACTGGTAACGCAAGAATGCAACAAAGACCAATTGCTCCTTTGGTCGAT
TCTTTGCGTGCTAATGGTACTAAAATTGAGTACTTGAATAATGAAGGTTCCCTGCCAATC
AAAGTTTATACTGATTCGGTATTCAAAGGTGGTAGAATTGAATTAGCTGCTACAGTTTCT
TCTCAGTACGTATCCTCTATCTTGATGTGTGCCCCATACGCTGAAGAACCTGTAACTTTG
GCTCTTGTTGGTGGTAAGCCAATCTCTAAATTGTACGTCGATATGACAATAAAAATGATG
GAAAAATTCGGTATCAATGTTGAAACTTCTACTACAGAACCTTACACTTATTATATTCCA
AAGGGACATTATATTAACCCATCAGAATACGTCATTGAAAGTGATGCCTCAAGTGCTACA
TACCCATTGGCCTTCGCCGCAATGACTGGTACTACCGTAACGGTTCCAAACATTGGTTTT
GAGTCGTTACAAGGTGATGCCAGATTTGCAAGAGATGTCTTGAAACCTATGGGTTGTAAA
ATAACTCAAACGGCAACTTCAACTACTGTTTCGGGTCCTCCTGTAGGTACTTTAAAGCCA
TTAAAACATGTTGATATGGAGCCAATGACTGATGCGTTCTTAACTGCATGTGTTGTTGCC
GCTATTTCGCACGACAGTGATCCAAATTCTGCAAATACAACCACCATTGAAGGTATTGCA
AACCAGCGTGTCAAAGAGTGTAACAGAATTTTGGCCATGGCTACAGAGCTCGCCAAATTT
GGCGTCAAAACTACAGAATTACCAGATGGTATTCAAGTCCATGGTTTAAACTCGATAAAA
GATTTGAAGGTTCCTTCCGACTCTTCTGGACCTGTCGGTGTATGCACATATGATGATCAT
CGTGTGGCCATGAGTTTCTCGCTTCTTGCAGGAATGGTAAATTCTCAAAATGAACGTGAC
GAAGTTGCTAATCCTGTAAGAATACTTGAAAGACATTGTACTGGTAAAACCTGGCCTGGC
TGGTGGGATGTGTTACATTCCGAACTAGGTGCCAAATTAGATGGTGCAGAACCTTTAGAG
TGCACATCCAAAAAGAACTCAAAGAAAAGCGTTGTCATTATTGGCATGAGAGCAGCTGGC
AAAACTACTATAAGTAAATGGTGCGCATCCGCTCTGGGTTACAAATTAGTTGACCTAGAC
GAGCTGTTTGAGCAACAGCATAACAATCAAAGTGTTAAACAATTTGTTGTGGAGAACGGT
TGGGAGAAGTTCCGTGAGGAAGAAACAAGAATTTTCAAGGAAGTTATTCAAAATTACGGC
GATGATGGATATGTTTTCTCAACAGGTGGCGGTATTGTTGAAAGCGCTGAGTCTAGAAAA
GCCTTAAAAGATTTTGCCTCATCAGGTGGATACGTTTTACACTTACATAGGGATATTGAG
GAGACAATTGTCTTTTTACAAAGTGATCCTTCAAGACCTGCCTATGTGGAAGAAATTCGT
GAAGTTTGGAACAGAAGGGAGGGGTGGTATAAAGAATGCTCAAATTTCTCTTTCTTTGCT
CCTCATTGCTCCGCAGAAGCTGAGTTCCAAGCTCTAAGAAGATCGTTTAGTAAGTACATT
GCAACCATTACAGGTGTCAGAGAAATAGAAATTCCAAGCGGAAGATCTGCCTTTGTGTGT
TTAACCTTTGATGACTTAACTGAACAAACTGAGAATTTGACTCCAATCTGTTATGGTTGT
GAGGCTGTAGAGGTCAGAGTAGACCATTTGGCTAATTACTCTGCTGATTTCGTGAGTAAA
CAGTTATCTATATTGCGTAAAGCCACTGACAGTATTCCTATCATTTTTACTGTGCGAACC
ATGAAGCAAGGTGGCAACTTTCCTGATGAAGAGTTCAAAACCTTGAGAGAGCTATACGAT
ATTGCCTTGAAGAATGGTGTTGAATTCCTTGACTTAGAACTAACTTTACCTACTGATATC
CAATATGAGGTTATTAACAAAAGGGGCAACACCAAGATCATTGGTTCCCATCATGACTTC
CAAGGATTATACTCCTGGGACGACGCTGAATGGGAAAACAGATTCAATCAAGCGTTAACT
CTTGATGTGGATGTTGTAAAATTTGTGGGTACGGCTGTTAATTTCGAAGATAATTTGAGA
CTGGAACACTTTAGGGATACACACAAGAATAAGCCTTTAATTGCAGTTAATATGACTTCT
AAAGGTAGCATTTCTCGTGTTTTGAATAATGTTTTAACACCTGTGACATCAGATTTATTG
CCTAACTCCGCTGCCCCTGGCCAATTGACAGTAGCACAAATTAACAAGATGTATACATCT
ATGGGAGGTATCGAGCCTAAGGAACTGTTTGTTGTTGGAAAGCCAATTGGCCACTCTAGA
TCGCCAATTTTACATAACACTGGCTATGAAATTTTAGGTTTACCTCACAAGTTCGATAAA
TTTGAAACTGAATCCGCACAATTGGTGAAAGAAAAACTTTTGGACGGAAACAAGAACTTT
GGCGGTGCTGCAGTCACAATTCCTCTGAAATTAGATATAATGCAGTACATGGATGAATTG
ACTGATGCTGCTAAAGTTATTGGTGCTGTAAACACAGTTATACCATTGGGTAACAAGAAG
TTTAAGGGTGATAATACCGACTGGTTAGGTATCCGTAATGCCTTAATTAACAATGGCGTT
CCCGAATATGTTGGTCATACCGCTGGTTTGGTTATCGGTGCAGGTGGCACTTCTAGAGCC
GCCCTTTACGCCTTGCACAGTTTAGGTTGCAAAAAGATCTTCATAATCAACAGGACAACT
TCGAAATTGAAGCCATTAATAGAGTCACTTCCATCTGAATTCAACATTATTGGAATAGAG
TCCACTAAATCTATAGAAGAGATTAAGGAACACGTTGGCGTTGCTGTCAGCTGTGTACCA
GCCGACAAACCATTAGATGACGAACTTTTAAGTAAGCTGGAGAGATTCCTTGTGAAAGGT
GCCCATGCTGCTTTTGTACCAACCTTATTGGAAGCCGCATACAAACCAAGCGTTACTCCC
GTTATGACAATTTCACAAGACAAATATCAATGGCACGTTGTCCCTGGATCACAAATGTTA
GTACACCAAGGTGTAGCTCAGTTTGAAAAGTGGACAGGATTCAAGGGCCCTTTCAAGGCC
ATTTTTGATGCCGTTACGAAAGAGTAG
Promoter Sequence
Download FASTA
>ARO1 YDR127W
TAGAACGAATACTGATCGTGCCTATAATTATACTACCGCCGGTAGCATTAGGAATTCTAG
CCATGGTAAGCAGAGCTGAGGATTCAAAGGATCATAAATCAGGCTCGACAGAGGAATATC
CATATGATTACCTATTGTATTATCCTGCCATAAAGTGTTCGACATGCCGGATCGTCAAGC
CTGCTAGATCCAAACATTGTAGCATTTGCAACCGATGCGTTCTCGTCGCCGACCATCATT
GCATCTGGATAAATAACTGCATCGGAAAGGGAAACTACCTTCAATTCTACCTTTTCCTAA
TTTCCAACATATTCTCGATGTGCTACGCCTTTCTAAGGCTGTGGTACATTTCTTTAAATA
GCACAAGTACGCTCCCTAGAGCTGTTCTGACTCTTACCATATTATGTGGATGCTTCACTA
TCATCTGCGCTATTTTCACGTATCTTCAATTGGCCATTGTAAAGGAGGGAATGACTACAA
ATGAGCAAGATAAATGGTATACCATTCAAGAGTATATGAGAGAAGGAAAACTGGTGAGAT
CATTGGATGATGATTGCCCATCTTGGTTTTTCAAATGCACAGAACAAAAAGATGACGCTG
CTGAACCACTCCAAGATCAACATGTTACGTTTTATAGCACGAATGCCTACGACCATAAGC
ACTACAACCTTACACACTACATCACGATTAAAGACGCGTCCGAAATTCCCAATATATATG
ACAAAGGTACCTTCCTGGCCAATCTCACAGATTTAATATAGTAAATTGTCATGCATATGA
CTCATCCCGAACATGAAATTTTTTTTCACTCGGTTTTTTCTCACCGCCATAGATTCTAAC
CGCAAATGTCGAACAAATTCATTATACAAGCGGTTTATTAATATAGAAGGTAGGACGCCG
ACTCGTAACCATTAGTAACAGATCACAGCTATACTCGGTCGTTCAAGTTTATATAATCTC
CTAGTTGAGAAATCCCTACGTAAGATAATTGTATATTACG
Chr coordinates Chr IV from 704484-709250
w3c xhtml validator w3c css validator