Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ENT5
Systematic Name YDR153C
Strain S288c
Description Protein containing an N-terminal epsin-like domain involved in clathrin recruitment and traffic between the Golgi and endosomes; associates with the clathrin adaptor Gga2p, clathrin adaptor complex AP-1, and clathrin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENT5 YDR153C
TGATGGCCAACCAATTGGCCGTGTCGTTTTCAAGTTGTACAACGACATAGTCCCAAAGAC
TGCAGAAAACTTCAGAGCTCTATGTACCGGTGAAAAGGGATTCGGCTACGCTGGCTCTCC
ATTCCACAGAGTTATTCCAGACTTCATGTTGCAAGGTGGTGACTTCACTGCTGGTAACGG
TACCGGCGGTAAGTCTATCTACGGTGGCAAATTCCCAGATGAAAACTTCAAGAAGCACCA
CGACAGACCAGGTTTGTTGTCCATGGCCAACGCCGGTCCAAACACCAACGGTTCTCAATT
CTTCATCACCACCGTTCCATGCCCATGGTTGGACGGTAAGCATGTTGTCTTTGGTGAAGT
TGTTGACGGTTACGACATCGTTAAGAAGGTTGAGTCCTTGGGTTCTCCTTCCGGTGCCAC
CAAGGCTAGAATTGTTGTTGCCAAGTCCGGTGAATTATAACCGCTCTGCCTGGAACAATA
CAGCAAAAATTGAAACGAACTATTCTCTCTTAAATTATATGTATATGTATAAGGTATGTG
TATGTATGACAATCAATTCTTATAACTAACTCTTCCTACCTATATCGGAGTATGTTGCCA
GGCTTGCCAACTAGCCAACTACCGCCTAGGTTATGCCTGTTAAGTTGACGCCGCCGGGTA
CCGCCCCCTGTTTTTCCCACGTTTCTTTCTTTCCTCTAGGTAACGGATTTTCGGCTTATT
TTCCACAGCGAGAAAATTTTCTTTCTCCTGCACTTTTTTTCATATTCAGGTCCTTTGATC
CATTCATTCATTCTTGTTTTAATTTCAATCTAGATTTTAGTTTTCGGTTGAATTTATCTT
TAGTTTTTTATCAATAAGAATTGGTCTAGCTTATCTTTCCAGGCTGCTTATAGTTTACTT
TTTTTAAAAAATTATATTTCTATCCAATATACAAATCGGAAGGGAAATTCATATACACAA
ATTAAACGTTCCAATTGCATAAATACCAACACCATACAAA
Chr coordinates Chr IV from 767971-766736
w3c xhtml validator w3c css validator