Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOM2
Systematic Name YDR158W
Alias THR2
Strain S288c
Description Aspartic beta semi-aldehyde dehydrogenase, catalyzes the second step in the common pathway for methionine and threonine biosynthesis; expression regulated by Gcn4p and the general control of amino acid synthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOM2 YDR158W
GCGGGTAACATCTAACAGCGACGGGTAAGCATATTGCGGGTGTAAAATTTTTCATTTCGA
GCTTACTTCAAGATGATGCATATGTTTAAATCACATTGATTATAGAGGTCTCATCGGTAA
GGCAGAGCAGAACTGGAGACGTCTGAGGTAAGATTTCGATAATACAAGATGATGAAAGGT
TCTAGAAGAACAGGTAATAACACTGCTACCACGCTAAACACGCCTGTGGTCATTCATGCC
ACGCAGCTGCCCCAACATGTCTCTACTGACGAGGTTCTTCAATTTCTGGAGAGCTTTATC
GATGAGAAGGAGAACATTATTGATAGTACTACCATGAATACCATCAGCGGCAACGCCGCT
GACGCGGACGCTGCCGCTGTGGCTAACACCAGCCTCAACATCGACACCAACCTTTCCAGC
TCCATATCGCAATTAAAGAGGATTCAGAGAGACTTCAAGGGTCTGCCACCCGCCCAAGAC
TTTTCCGCCGCGCCCATTCAGGTCTCCACGACGGAGAAGAAGGAGACAAGCATAGGTGTT
AGTGCCACCGGCGGCAAGAAAACTACATTCGCCGATGAGTGAGACCTGTAGCAGCAGCCT
TGCCCTTTTACACAAAATCCTACATATCCATTCACATACGCCTTCTGTATACTACAATAT
ATGCATATCAGTTAGAATTCTGACATCTGAACGTCTTCAGTGCTTTTTTTTCTCTTTCTT
TCCAGATCCAAATATCACCGGCAGCGGCCTCAAAGTACCCGGTTTTCTTTTTTTTCACAC
TTTTTTTTTTTCCAAATCATGTTGTCAAGCATTGATTGACTCATTTTCCTCTGACTACTA
CCAGTTCAAAATGTTAGAGAAAAATAGAAAAGCAGAAAAAATAAATAAAAGAACCATATT
TATTTGTTCATTCACTTTCGAGTATAAAATTAAATCTTGTTTTTCTTGTTTTCACTTAAG
TACACATACAAATTAAATTGTAGAAATAAAGCGTTCTAAA
Chr coordinates Chr IV from 770357-771454
w3c xhtml validator w3c css validator