Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP42
Systematic Name YDR171W
Strain S288c
Description Small heat shock protein (sHSP) with chaperone activity; forms barrel-shaped oligomers that suppress unfolded protein aggregation; involved in cytoskeleton reorganization after heat shock
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP42 YDR171W
CACTAGCTTCACCTAAAAGCAAAAAATCTCAAAATTCCCAATATTCACATAGTCTAAAGT
ACCGATAGCAACCAACATATATAAACAGTAGTATTTTACGAAGCTGAATTGCAAGATTAG
TGAGAGGAGAATAACCGGATAATTTTTTTGGATTACGTTATTGTTAAAGGCTATAATATT
AGGTGAAACAGAATGTCCTAGAAGTTTTTTTCTTTCATGTTAAATTTATTGATTCTTGCG
CTTCAGCTTTTATAAAACATAAGAACTGTTTCTTCACGTTAACTTCTTGTGCCACATATA
ATGATGTACTAGTAATATGGGTACTATTTGGCAGATGATATTTGATTTTTATTCAAGACG
GTTACTGTTTCTACGATTGATATTTTCATTCCTGGATATCATCTTGCCAGATCACTTACA
ATTTAGGCCGCGCCTGAATTGAAGAGTACTTCAATACGTAGTGTACTGTCCAAACTCTCT
TCCAAATTTTTAATATTTAGCTGGGGTTGGGTAACAAGTGAGCAAGGGAAAAAGTGAACA
TTTTAAGAAGAACAATAAAATAGCAAGAGATGGAATGGTAATGCTTGGCTCTCGAGAAGA
GTAGCATAAAACGAGACTTGTTTAAAACAGGATATGACATACTTCAATTCAGCTTTCCCT
ATCAGCCGCTCGAGCAGTTATATAGGTGTGTTGCCGGAGTAATTTGGCGGAGGCCAACAG
TGGCTAGGCGGCAACGCCTGGAACACGCGCTTAAAAGTTCTGGAAGGTTCGCGAATTGAG
AACTGCTCAGGGGCGAATACAGGGGCGGCCTTGGCGGCAGGGGGGAGGCCTCTGTGAAGT
TAGTTATATAAGACTTGCTGTCATCGTTTTTTTGATCCCGGCAGGAACTATCTTTTATTC
TCATACATACGGTCAAGAAGTATAATTATACATAACATAGGGACACGTTCAGGCAATTGT
CCATATCCCACACAAATTAAGATCATACCAAGCCGAAGCA
Chr coordinates Chr IV from 806621-807748
w3c xhtml validator w3c css validator