Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CSN9
Systematic Name YDR179C
Strain S288c
Description Subunit of the Cop9 signalosome; Cop9 signalosome is required for deneddylation, or removal of the ubiquitin-like protein Rub1p from Cdc53p (cullin); involved in adaptation to pheromone signaling
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CSN9 YDR179C
GCAGAATTTAGCTTTATTCTTATGCAAATTTTATTCAAGCCCTCCAGAAGATAATATGGT
TCCGCTATTGAATTAAAAATATGCCCGAACACAAGTTCATTTAAAAAGCTATCCAAAAAG
CTTCTCTGTAGTAGAGATTTGGTGCTCATTTTACTTTGTATGATTTCAGTGAATAGCATT
GGATATCGTTTCGAATCATACAAAGTTAGCTTACAGTACTGTTCATAAACTAAATCGTTA
TTTTGAGATGAGTCATTTAATGCTTTCAAGTGAGACGAAAGCAAGCAGGGAATATAATCG
AGTAAAAGGGCATGGTAATTGATTTTGGAACTCTTCAAATATGTTATTAAATCTTGAACT
AAGTTATATAGTTCGGTTAAAAACTTGGAATCATCAGTGGGTATTTTGATACCATACCAA
GACTTAACGAAATTTTGGAAAATTAAGGCAATAAAGGTATTTACCTGTAGGTCTGGCAAA
GCTTCTATGCTTCTGATTTTCTGATGTAATGAATTTGGGTATATAGAGAAACATAAATCC
CTTAGATACTCAACCGAATCTTTTTCAAATTCACTCTCAAACGAAACATCATTACCAGAA
TTTTTCGTATGACTACAATCTTTCTCCCAAATATCTCCACTCGATTTAGAATTCAGTCGT
GTATGTCCTTTTTTTGACAGAAAGCCTTTATATTGATTTGAGGCATTTGGCCTTCGGTAC
TTGGTAATTAAACTGGAATTGGTGTTGTATAAAATGGTAGGCATCTACACATATAGAAAT
AAAGCCGTGCAGTATATATTGACTTCCCTGGCTCTTATCGCGTTTGCTTTTTCTTATATT
ATTGTTATCTTGCCTTTGGTTCGTTGTATCTTAGGGAATGCGAAAATTATTGAGCAACTC
ATCATCAACTTTTTTAATATGTATTTATATTACGGACAATAGTAAACAAAGAAATAAAAA
ACAATAACAGTGATGACCTACGTAGTACAGATAAGAGAGA
Chr coordinates Chr IV from 819196-818708
w3c xhtml validator w3c css validator