Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HST4
Systematic Name YDR191W
Strain S288c
Description Member of the Sir2 family of NAD(+)-dependent protein deacetylases; involved along with Hst3p in silencing at telomeres, cell cycle progression, radiation resistance, genomic stability and short-chain fatty acid metabolism
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HST4 YDR191W
GTAGCGTATGCATCAGATCTGCCAACTCGCTTAACTGCACCGGTGTTGGCCTCTATATAA
ATGACATCACCAATACTAACCTTTTCTCTTTGAATACTTTCATATATCGTTGGGTCTAAT
CTTAGTGTCTTGGTACCCTTGGCAGACTTGAGCCCGACAATTACATGTGAGATAGTTTTA
CCATATCCGCCCAACGGATTCTCTGCGTCTTCAGGGGTTAGTTCTGTCACTTCACCCTCA
TAAACTTCCTTAGTTTCTTTGATTCTTAACCCAATTGCTCTTCTAAAATTTTCCATTAGG
GTTTCTGTTTTTTTGACCTCCACGGAATATAATTCGCTACCAACAAGAGGACAGAATGGA
ACTTTTGGGCCTAACTCTTGTGAAATGGCGAGAGCCAATGCTGTCTTACCTGTAGAAGGA
CCACCAGCTAATAGGATAGCTCTACCTGACATTTTTTTAGCCTTGATTAAATCTACAATT
ACACCGCACGCTTCACGAGCTTCTATTTGTCCAACAAACCCTCCTTCAACCCTCTTGGCC
ACACCACTTTCATCCAGACCTAAACCTTTAATATGTGTATGTGCCGCAGTTCTCGTAACT
GCACCAGAATTACTGCTGTTTACGCCAGGATTTTCTTTGACTTCACTGATAGCGACCATA
TTTACTCAATTATTTTAACGTTCAAAATATTCAGGCCCAGAACTTAACAGCCTTCAATAC
GTACTCTTAAATGAATCCATCTCTTCTTCATCACCACGATGTATCTTTTGTTTTGCCATA
TTCTTCCTTGAACAAAATTGAAAAATTTTAAAAAACCTCTCCATTACCCGCAGAGCACGT
GAGCAAAAAATCAATTACGTTTCCTAAAAGGGGAAAACAGCAACTTTAGTGACATGTTAG
AATATTTAGCAAGCAAGGTTGTGGAAAAGCTTAGGAATTACATACTTTAGAGCAACAACT
GTATTTTAAAACTGTAAATAATACTAAGCAGAACCACAAA
Chr coordinates Chr IV from 842337-843449
w3c xhtml validator w3c css validator