Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EBS1
Systematic Name YDR206W
Strain S288c
Description Protein involved in inhibition of translation and nonsense-mediated decay; interacts with cap binding protein Cdc33p and with Nam7p; localizes to P-bodies upon glucose starvation; mRNA abundance regulated by mRNA decay factors
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EBS1 YDR206W
TACTTAGCGCTCTGCCCCTGCTAAAATCTACTTCCGCAAATATTTTACTAAGACTGGATG
ACAAGAAGCATAATCTAGTAAAGAGTGCGCTAAACCAGATTTCAACGACGCCAGGAATCA
CAGGTTATACAACTCCTAGATTTTGGCCGACAGAGTCAGGCAGTTCCGGGCATTCACATG
CACACACGCATTCTCATGCAGAGAATCATAGCCATGAGCATCATCATGATCAGAAAAACG
GTTCACAAGAACACCCGAGCTTGGTGGGCTATATTCATGTACAGTATGTAGACGGCGAGA
ATTCGACAATTATCAAGAAAAGAGTTGAAAAAATATTCGAAAATGTGTCGATTAAAGCGT
GGGTACAAGTTGAGCCTCAAAATTCCACTTGTTGGTGCCGGGCTACTTCTATGAACACAA
TTTCAGCTAACCCGAATTCTTTACCGCTACAGCCTATAGCAAATTGACAATTCTTTGTCC
TGCATACCTTTTATATTAATTTTTTAAACAAGATTTCATATACATAACGGTACCTATCGT
AATTATTGGCGGCTGCTTGTGTTGATCACGTCTTACGGGAAATATCACAATGGAAGAAAA
AAAATACTTCTAACGAAGGAAAAGATGTCATCCAGCATTGACCTCAAATTACCGAAGAGG
TTGATAAAGCAATTAGCATCCAATCGGTATCATAATTCGGAAATTAAGGGGGAATCCTCT
ACATTTGGTGTTTCTTCTTTCCATATATTTTGAATGTTTTTTTCCTATGAAAAGTGTCTT
CAGGAATCATATATGTAAAGAGATCATTCAATTAAATACATCATCGAACTAAGATTATAA
ACAAGAATTTAACAAAGTCACTTAATATATCAAAAAGAAGGCTTTTAGGAACTCAAAAAT
CCGCATCATTTGCAATTTAAAACGTACGTCATCAGGCGTATATATTCAAAGAAAATATCT
CAGTTTCATTGCACTGGCTTACAGTTGATATTTCAATTAA
Chr coordinates Chr IV from 862054-864708
w3c xhtml validator w3c css validator