Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AHA1
Systematic Name YDR214W
Strain S288c
Description Co-chaperone that binds to Hsp82p and activates its ATPase activity; similar to Hch1p; expression is regulated by stresses such as heat shock
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AHA1 YDR214W
TCGTTAGCAAATGCTAGTGGTAACGGCACTGTAGGAAACCAAAGTTTGAATAGCATGTCA
CCAAGCGCTTGGATCTTTCATGTCAAAGGTGCTGCAACAATTTTAACCGCTGTGTGGCCT
TTGAGTGAAAGATCTAAATTTCATAACATTATATCTGTTGATCTTAGCGATTTAGGCGAT
GTCATTAACCCTGATGTTGGAACAATTACTGAATTGGTATGTTTTGATGAAAGTATTGCC
GATTTGTATCCTGTCGGCTTAGATTCGCCATATTTGATAACACTAGCTTATTTAGATAAA
TTGCACCGTGAAAAAAACCAGGGTGATTTTATTCTGCGGGTATTTACATTTCCAGCATTG
CTAGACAAGACATTCCTGGCATTACTGATGACAGGTGATTTAGGTGCAATGAGAATTATG
AGATCATATTATAAACTACTTCGAGGATTTGCCACAGAGGTCAAGGATAAAGTCTGGTTT
CTCGAAGGAGTCACGCAGGTGCTGCCTCAAGATGTTGACGAATACAGTGGAGGTGGTGGT
ATGCATATGATGCTAGATTTCCTCGGTGGCGGATTACCATCGATGACAACAACAAATTTC
TCTGATTTTTCGTTATGATAGAAAATTTAAAAGTGCAGAATATTCGAAATAGATTCCCAA
AAAAAAAAAAAGGGATATTGTGTTACCCAGTTCACAATGGAATTTTCTAGAAGAAAAAAC
AAAGAAGCCTCGCAACAAACCAAGATGGATTCAAAATGCCTACTTACCGCATTGTATGTG
GGAGAATGAACATATCTGTAATTGTATTATATAAAAGTAGTTAGTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTATGTGTAATGCAAATACAAAAAGAACTGCAGGCATTTTGAAAG
TTCACTCGTATAGGAAACTTTGATAGAGAGGCAATTCCTTACTTTCGTTATTCCTTTCAG
TCTTATTCTTAATCGTTTATAGTAGCAACAATATATCAAT
Chr coordinates Chr IV from 892875-893927
w3c xhtml validator w3c css validator