Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HEM1
Systematic Name YDR232W
Alias CYD1, OLE3
Strain S288c
Description 5-aminolevulinate synthase, catalyzes the first step in the heme biosynthetic pathway; an N-terminal signal sequence is required for localization to the mitochondrial matrix; expression is regulated by Hap2p-Hap3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HEM1 YDR232W
CACGGTTTCCTTTGCCAATTGTGCGATCTGGAAACTTTTTTGTCTCTTTAGCCTACATTG
CTCCCATCCGACAATCGAGCCCAGTATCAGAGAGCTCATCGCCCAATTCGTGGCCTTAGT
CGGGCTCTTATGGTATATAAATATAATAGATCCCATCAAGAACATGCTGGAAAACCCGAG
CATGCCCGCGTCTCTGAAGCACGGGATTGAAGTCAGCTTCTGCAAACTAAAATCACTCCA
TCTGATCGAGTCCCAAGCCTCTTTCAAAGTAGCCCGTTCTTGCTTCTTGGCCAACTGAGA
ATTGGACAAGTCATCGGCAAACTTGGGTGGAGTGTCTTCTAAGAGGATCTTTTGACCCCG
CGAGTAATTTGTCAGCACGCGATCACCATCTGCTTTACCCTGCGGTTGTTGCTGCTGCTT
TTGATCTTCTGTCTGATTTGACCACGGCCACCAACGCATCTTTATATTAACTGTTGAGCT
GCTCGTTACGCACTGCTGTGGACTTCACTACAATGCTTTACCGAGCAGTGGAGTTTGATA
TAGTGGTGGTACCCCCGACGGTGCTATAATAAGCTTGCCTGCACGGCTTACCCTACCGCT
CGGAAAGGCCGCCTTCGTCGCTCATTGGTCTGCGGCCGCGGGCGCTTTTTGGTCATTGTT
CATATATGAAGAAAGAGCAGGAACGGAAATTTTTCATCTTGCCTTGCCCATTGTTCTGAT
CCATGCGTTGTTAGAAATACAACGTTTGCATCATACCAAACTTCTCCATTCCGTCAGCTG
ATACTCTATTCGGTTGTGTGTTGCACCCTGCTCTGCTGTCTCTCAACCGTTCTTCCTTTA
CACGCCTTCCCTTCTCAGCTCGCGTTTCTTTTTTTTTTATCCCACTCTTTTCTTTTTTCT
TTCCTATATATTGCCCATATAAGTTTGGTTGGAAGGAAAACTAATAGAGCTAGTTGTTGT
CCCTCAATAATCATAACAGTACTTAGGTTTTTTTTTCAGT
Chr coordinates Chr IV from 927452-929098
w3c xhtml validator w3c css validator