Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDR248C
Systematic Name YDR248C
Alias gluconokinase
Strain S288c
Description Putative protein of unknown function; sequence similarity to bacterial and human gluconokinase; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP-II associated factor, PAF1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR248C YDR248C
ATCATCCTATCCTGTTGAAAAATATTTCTCATTTTCTTCCCAGAAAGCACTATCAAGATA
TGCAGAATGGCGATTTTGATACATCTAAAGAGCTAGACTTGTGTTCAATGAACACTGAAG
ATACATCGAAAGAAGACTTCCCTAAAAACTTTTACAACAATATGCATATTTTTTTAACAC
GTAGGGAATGTGTGAAGTCTCTAGGTAATCATTTTACTTTGAAGAATCCATATGATGTGA
TATCCCCTTTTATAGAATGGTTTTTTCAAGGTATTGATATGCAAGGAACTGACCTAAGCC
CTAAGTTTACCTTTGTTTCTCTATTTGAATCAATAGATTTAATCCTATACGTCTCTGGAT
CTACAGTGCAAAAACTAGCGTCTATTGAACCCCTTACGACTGTAATATTTTTATTATATT
TCACGTATGCTGATTCACTAGGGAGTCTGAACTTTGAGTTTTTTTTGCAGAATAGATCAA
GATTACAGCTCATAGAGAAATTTATCCTGAAATATTATTACAATCCATCATTGACAGAAA
ACGAACTTTTATCTGATAGCACTATATGGGACCTGTTAAGGCGGGTGTCTGATTTAAAAC
TCATAGATTTGGTCGTTAAATGCGGCGGAAGGCCTCAATACGGGGTTATGTTTGCATAAT
TAAATTACTTAGTATTAAGATTCTGCCCCTTGCATGCATGCACAATATGTGCTTGCCAAT
TCATTTATGTACAAAAGATGGTGTTATATAAGGAATATATTTTGTTTTCTTTGATATTTT
CCCTTTCTCATATTCTTGCGGTTTTTCTGCTTTCATTACGTCGCTAATTAGTTTGTCAAA
AATTATAACACCGTTAGTTTCCAAGCAATAATTATATAAGGTCCCGTTAAAAAATATCGA
TAATCAAAAGGTTTTCAAGTAGCAAGCAATAAATAGCTTTCCGAAGACTAAACAGGCTTT
CATAGTGTCTCAGTAAGCGTATGGATGGACAACGCAGTTG
Chr coordinates Chr IV from 958339-957758
w3c xhtml validator w3c css validator