Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCC2
Systematic Name YDR270W
Strain S288c
Description Cu(+2)-transporting P-type ATPase, required for export of copper from the cytosol into an extracytosolic compartment; has similarity to human proteins involved in Menkes and Wilsons diseases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCC2 YDR270W
ACCTGTAACTATGTTGGCACAAACGAAAAAAGTTTTGAGCTTAAGCACGCCTGAAAAGAA
AATGTCCAAGAGTGATCCGAATCACGACTCTGTAATTTTTTTGAATGATGAGCCTAAGGC
AATTCAGAAAAAGATTAGAAAAGCTTTAACAGATTCCATTTCTGATAGGTTCTACTACGA
CCCTGTAGAAAGACCAGGCGTATCGAATTTAATTAACATTGTCAGTGGCATTCAAAGAAA
ATCGATTGAAGATGTCGTAGAAGATGTATCTCGTTTCAATAACTATAGGGATTTCAAAGA
TTATGTTTCAGAAGTGATAATTGAGGAATTGAAAGGCCCAAGAACAGAATTTGAGAAATA
TATCAACGAACCGACCTATTTGCATAGTGTCGTTGAATCTGGCATGCGCAAAGCGAGAGA
AAAAGCAGCAAAAAACCTGGCCGACATTCATAAAATAATGGGCTTCTGACTGTCCCCGGC
TTTAGGCTGCTGCAAACGCAATGTAAATAATAATACAGTTTAACTTGTACGTATCTTTGT
TATTTCAGAATATGCAAGATTCCTCACTCGGCAGATCTCATCAATAAACGTTAGTATCTT
GAAAAATACGCAGATGTTGGTACAGTCTCTTGCAGAGGGCCAGCACCGTTAGAATGTTGT
GTTGCCACCGTCTGGCTCGAAAACAGGTCGATCTGTGTAAGTATTGTCCTGGGTGCAGTT
ATTTGTAGTAGCGATTTTCGCGGGCAGTGGAAAAGAACGGGTGCAGTGCGGCGATGAGTG
CAATTAGCTGCCGAAGGGTTTGCACCGGTGATTCCGAGACCTTTTGCACACACTTGTATA
TATTTAGGGAAGTCACGGTAACTAATGGATTTCTTCTCAAATTTGAGACATATGGATTAG
ACTTTAATTCTGCCTGGTACTAAGCTACTTTTCAAAGGTATTTGAGATATTTCGTAAATT
TTGCGGCCAAGGAGTTGAGGTGTTTAATACTTAAAACGAA
Chr coordinates Chr IV from 1005675-1008689
w3c xhtml validator w3c css validator