Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BSC2
Systematic Name YDR275W
Strain S288c
Description Protein of unknown function, ORF exhibits genomic organization compatible with a translational readthrough-dependent mode of expression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BSC2 YDR275W
ACAAGAATTAAGTTTTACGTAGTGTATAGCGGTAATGTTTATTAACTCTTTCGGCAAAGT
GCGTTTGGGCTCGCAATGAACAGACACCACCATTGCTTCTTCTGCGCTTATTTGCCTTTG
TTGTATATCTAGTTCTCAAAATGGAGTCATTCATCAGTCGATGTGTGGGCGGAAATGACG
TTCATCTAGCAATGGCACACTAGTTTTTACTCAACAATTCAAACTCAATGGAAAGCCAGG
AAGTTAGCGCCGGGAAACTTCAGGACAATATAAAAACAGGACTAACGGAAGAAAATAATG
TGGGCCTTTTTGAGCAACGCTGACGGTAAGTAGTTTCCTACGATCGTACAATCCCGGAAA
ATTGTAGTGGTGCAAGAAGGGAAAAGAATGATGGCGAAAAATGCACGCGCGTAAATAATG
ATTTGTCGAGTCCTATTGACCACAAAACCCGCGGAAACCTAGTTAGCCCAAAAGGAAATG
GATAGCATATGAAAAACGAAACGAAACGTCCTTTTGCACGGCAGAAAGAGCTTAGTAGGA
CCCGGGACAAATGCAAGTTAGATTCCTTGATTCCCGAATGCTCGGTCTTGCGTTTCGCCG
TGGCTGCATGGAAGGTCATCGTACGGGTACGGGCAGTCTGGCTGAGTGGTGCCGCCAAAG
TGCAATAGCTGTCAGTAGGGCGTGAGGAATGTAAAAGGCAAGAAAACATGTACGAGGGAA
GAGAAGGGGGCAAAAGAAAGATAATAGGAACGGTGTAGATGAACTAGAAAAGGTTCAAGA
GATGATAAACGTGAAGGGAGTGTCATATCTACCGACATAAAGATAGAGATCTTTTTTTTT
CCTTTATTTTTTTTTTTGATTTTTTTTTTTGATTTTCTTGATATTAGTTTTTAGAAGTCC
TTTGACGGGGCAGCCGGAGAATATATACCAACGGCATTCTATTGTCTTTTTTTCTTCCTT
CCTTGCCAGGCATCTGCATCCATTATTGCCTTTAGTTACA
Chr coordinates Chr IV from 1012252-1012959
w3c xhtml validator w3c css validator