Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNH202
Systematic Name YDR279W
Alias Rnh2B
Strain S288c
Description Ribonuclease H2 subunit; required for RNase H2 activity; role in ribonucleotide excision repair; related to human AGS2 that causes Aicardi-Goutieres syndrome
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNH202 YDR279W
CACTGTTAATTACGATTCGCTCCAACAAATTTGGTTTTGTGGATTCTTAAATTCTCGAGA
AAAACTTCTAATATATCTTGTATACCAGATACTGTAGCCTTTAGCAACGATAGAATACGA
ACAGTTCTCTTAAAATTCGCCTATTTCTCATACCGTTGCAGATATAACTAAAGTATTGAC
ATTCAGTGACATCTGGCGCTGATATCATTATTTAACACACGTATGTTTGCGTGGCATTGT
CATTTTTAAGAGCAGAGAAAGAAACAATGAGCTACTTGAGTGTGACAAGTTGAAAAGTCC
ACCAATTTCACGTTGAATTAGGATTCATATATGAAATTCTAGTCATTAATTAGAATTGTA
AGTTTCTGAGCTTTTTTTTCCTAGTAAATTAAACTTGTCTAATACATCCAGTTGTGATGT
ATTCTATATCTCAGTTCTACAGTAGCACGAAGTTTCCCGGCCTCTCTATTCAATAAATTC
AGCTATCGCTGATTATCAACAGCAGCAACGAATAAAGCATAAAAGAACAGAAAAATTCTT
CTACAAATTTATTCTGTAAAGATTCAGCTTCTTTCGTGAATTTCTAAGTTCATGAGGGGA
ATTTAAGTATGGCGTTTCTTCGTAGCGCCATTGTCTTGAGCCAAAATGGAACTCTAAAAA
TTTTCACGACATTTTACTAGTCAGTAAAGTGAGCATATACATATAAGAAGAAATTTCAAA
AGGTAAAAAATGGAGCAACTTCCAGCTCATTATCTTTTCAATGTTGTCGATGCCATAGTT
GGATTATGAAATCTCATATTCATAACCACAACGCGTTTTTTTCCTTTTAAGGCACTACAG
ACTCCATTCTCACAAGTTTGTCAAAAGCACGAGCGCGATGAGAATTAAAGTCAGATCTGG
TTAATGATTCTGGTACAACAGCAGAAACAAATCGAGTACAAATTTAATCTTATTCTGTCG
CAATAGTTGACTTTCTTTTCTGGCCTCTCGAACAAAAAGC
Chr coordinates Chr IV from 1019368-1020420
w3c xhtml validator w3c css validator