Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHM6
Systematic Name YDR281C
Strain S288c
Description Protein of unknown function, expression is regulated by phosphate levels
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHM6 YDR281C
TGGAAGCGCGGAATCTCGGATCTAAACTGATTGTTCAAGCATTTATACGTTTGGGTAGTT
CAGCTAGGGAAGGCCGTGTTTTATCTCATGTTGTTCGTTTTGTTATAAGGTTGTTTCATA
TGTGTTTTATGAACGTTTAGGATGACGTATTGTCATACTGACATATCTCATTTTGAGATA
CAACATTGTATATACACAGAACAATGAGAAAAAGTTCCACTCAGTAATTAATATTCTTTT
ACCCAACGTTTCCTTATAACGTTGTTATTGAAAAAGGGATATTATATGAATCCACGCACC
TGATCTGGCTCTTAGAAGCGACTAAATAACTACATATGTAAGAGATCTGCTCCTGCCACA
AGAGAAAGCGTTTTTTAGCGATAAAATCAAGATTTCTCATTTCCTAATTGCTTATGACGG
ACGACCTTCATTATTAGAACGTGCAAATGTGCATTAGCGTGTAATGATACATACGCAAAT
TACAATAAAAAATAAACATGTAAATAAATGAGCCCACTTAAAATAATATGACATATATTA
GTTTGCACTGTCATGAAAACCCTGATAACGTGGTGTCATTTTTATTACACCCGTATATTC
ATCAGCCCGTCCTAACCTATCCGAACGACGCAGGATGGCCACTAACATCGCAAATAGTGT
TATTACTTTTTCCATTTGGATGTTCTGCCCTATAATGTTACGCAGTTCCGAGCTTCGCTG
ACACGTGGGAGGTGGGATATAATATTTGCACGGGTTCTTTTTTGTGTCGTCTGGCGGAAA
AAAATAGACTCGTCTCTTGTATGGCGCGCTAGTAATTTATTATTTGCGATGCGCAGAACC
TTATCTTTTGTTTTCTATTCAGTATAAAACTTGAACGATTTCACCAGATGTTTGTACACT
TTGATTCATTGCAGCCCAAATAGAATTTTTGTCAACTGCCATACCAAACTTGTTGAACTA
AAAAAAAACGACAGCAATTGTTTTTCAACCTGACACCAAG
Chr coordinates Chr IV from 1022321-1022007
w3c xhtml validator w3c css validator