Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHM6
Systematic Name YDR281C
Strain S288c
Description Protein of unknown function; expression is regulated by phosphate levels
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHM6 YDR281C
TGGAAGCGCGGAATCTCGGATCTAAACTGATTGTTCAAGCATTTATACGTTTGGGTAGTT
CAGCTAGGGAAGGCCGTGTTTTATCTCATGTTGTTCGTTTTGTTATAAGGTTGTTTCATA
TGTGTTTTATGAACGTTTAGGATGACGTATTGTCATACTGACATATCTCATTTTGAGATA
CAACATTGTATATACACAGAACAATGAGAAAAAGTTCCACTCAGTAATTAATATTCTTTT
ACCCAACGTTTCCTTATAACGTTGTTATTGAAAAAGGGATATTATATGAATCCACGCACC
TGATCTGGCTCTTAGAAGCGACTAAATAACTACATATGTAAGAGATCTGCTCCTGCCACA
AGAGAAAGCGTTTTTTAGCGATAAAATCAAGATTTCTCATTTCCTAATTGCTTATGACGG
ACGACCTTCATTATTAGAACGTGCAAATGTGCATTAGCGTGTAATGATACATACGCAAAT
TACAATAAAAAATAAACATGTAAATAAATGAGCCCACTTAAAATAATATGACATATATTA
GTTTGCACTGTCATGAAAACCCTGATAACGTGGTGTCATTTTTATTACACCCGTATATTC
ATCAGCCCGTCCTAACCTATCCGAACGACGCAGGATGGCCACTAACATCGCAAATAGTGT
TATTACTTTTTCCATTTGGATGTTCTGCCCTATAATGTTACGCAGTTCCGAGCTTCGCTG
ACACGTGGGAGGTGGGATATAATATTTGCACGGGTTCTTTTTTGTGTCGTCTGGCGGAAA
AAAATAGACTCGTCTCTTGTATGGCGCGCTAGTAATTTATTATTTGCGATGCGCAGAACC
TTATCTTTTGTTTTCTATTCAGTATAAAACTTGAACGATTTCACCAGATGTTTGTACACT
TTGATTCATTGCAGCCCAAATAGAATTTTTGTCAACTGCCATACCAAACTTGTTGAACTA
AAAAAAAACGACAGCAATTGTTTTTCAACCTGACACCAAG
Chr coordinates Chr IV from 1022321-1022007
w3c xhtml validator w3c css validator