Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NSE3
Systematic Name YDR288W
Strain S288c
Description Essential subunit of the Mms21-Smc5-Smc6 complex; protein of unknown function; required for DNA repair and growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NSE3 YDR288W
TCCCAGTTTCAAATTTATCGGAGAAGAAACTTATGTAAAAGGTGTCACGAAAATAACTAA
CGGCCCTACATTTATTGTTGATCCCATCGATGGTACTACTAATTTTATTCACGGTTACCC
CTATAGTTGTACATCTCTAGGTTTAGCTGAAATGGGGAAGCCGGTTGTTGGTGTGGTTTT
CAATCCTCACTTAAACCAACTATTCCATGCTTCCAAAGGCAATGGAGCTTTCTTAAATGA
TCAGGAGATAAAGGTTTCAAAAAGGCCATTGATTTTGCAAAAATCCTTAATTGCTTTAGA
AGGAGGTTCGGAAAGAACTGAAGGTTCCCAAGGAAACTTTGATAAGAAAATGAATACTTA
TAAAAACTTACTAAGTGAGTCCGGCGCCTTTGTTCACGGGTTCAGAAGTGCAGGAAGTGC
TGCCATGAACATATGCTACGTAGCGAGCGGCATGCTTGATGCTTATTGGGAAGGTGGCTG
CTGGGCTTGGGATGTTTGTGCCGGTTGGTGTATTCTTGAGGAAGCAGGAGGAATAATGGT
TGGCGGAAATTGTGGAGAATGGAACATTCCATTAGACAGAAGATGTTACTTGGCTATTAG
AGGTGGATGTGAGTCGATGGAGCAGAAGCGATTTGCAGAATCGTTTTGGCCTCACGTTGC
GGGTGAGTTAGAATACTAAATGCCCCCCTCAGGTGTCGTTAAATAAGCTACATCTAAGAA
AAGTTTATATAGTACTTCACGCAATTCCTACTAGTATTTTTTTCCAGTACAGGACGATAT
CTTGAAGCAGCAACTTGATTTCACAGGTCACTTAGTGTGGGCTTCTGACTCAAGAATAGC
AAGTATTACATGCATGCGGCCCTCTCCTTTAACAGCGCGATATACGTGAAGAAAAATTTC
AATGAAGAGTAATGCGCTTATTATCAACTTCGATTGAAGGGGTCCTATATCAGTATGCTA
CAAGGGAAGGTTGTTCGATAAACATAAGCTTCTCATTAGC
Chr coordinates Chr IV from 1037195-1038106
w3c xhtml validator w3c css validator