Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATP5
Systematic Name YDR298C
Alias OSC1
Strain S288c
Description Subunit 5 of the stator stalk of mitochondrial F1F0 ATP synthase; F1F0 ATP synthase is a large, evolutionarily conserved enzyme complex required for ATP synthesis; homologous to bovine subunit OSCP (oligomycin sensitivity-conferring protein); phosphorylated
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATP5 YDR298C
TCCACCTCCAAATAGTGCGCCTTCTTGGTTTCTTCTGTGTTGCTATTTCCATAGTCGCTT
AAATCACTTTCTCCATTTTTTTCATTGTGTTGAAATAAAGATGCATTTTCCTCATCTTCA
ATATCGAAGTCTTTATTGACCGGTTTAATGGCGATATCGGAAATTTGATCCGCTAGTGAT
TTTTCCATCTTTTTTTGCTCTATATTTATTGGTAACAGTGCTTATTGTTACTCAATGTAT
GGTACGCTGCATACCTATCAAGATGCGACTACATATATACAATTATCTCATCTCATCGCG
TATTGAAAAATTTTCCATCTTCTAATTTTTCAGAACCCATAAATTCGGGTAACGATCAGT
GGAAAAAACTTAAATCCGCAGTAATAGGCTTGCAAAGGACCAAAGACAGCATATGCAGCA
GTTAAGAAATCTAAGAATGCATTGTATATTAGAGTAGTATATGGAAAAGCTCGGACTGGG
AGCCGTAAAATCTCTTTCCCGTAAGATCTGGCTGCAAACCTGGTCTACATAAATGTAGTA
CATTATAAGGGACTACCAAGAAATACGAAGCGCTCAGATATCTCTTAAAGTTCATTTTTT
TGCCGGAATAATCTTGGTTTAGTAACTTATAAAACTACTTACGTCCAATAAATCGTTATA
TTTTATGCCGTCGTCATAAAGTGGACACTTTCGAGAGACGGTGCTGGCCAATAAGATGCT
GATATTTGAAATATCATTTACCCGGGCCCGGGTGGGAAAAACAAGGAATTAAAGATAATG
AAGTGATCTTTTGGCGAGATAGTAAAACTTTCAATTATCTAGGAACAATTTCAAACGCCA
ATTGTTAACTTTGTGTACAGTATTTCTAGTTTTTATCTCATTGAAAACAAAATTCAGTCA
ACTTGGAAATTTAAGCAGGCTACTGTGGCATTGAGATATTTTTCCGCAGAGTAAGAACCG
ATTAGCAAGTTACCGCATTATTTTTAAACCGTGGACAATC
Chr coordinates Chr IV from 1058814-1058176
w3c xhtml validator w3c css validator