Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OMS1
Systematic Name YDR316W
Strain S288c
Description Protein integral to the mitochondrial membrane; has a conserved methyltransferase motif; multicopy suppressor of respiratory defects caused by OXA1 mutations
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OMS1 YDR316W
ATTTTTTGGCTTGATGTCAACTGGCTGTAAGTTTTTGTCCAATGGGTCCATTTTTCTTTT
GGCTTTAGATCTACATCTATTATATTCACGTGCAACGCATTTTCAGCACTGTTCCATTCA
ATGAAACATGTCACGTCTCTGAGTGTCATGAGTAGCAGATGCTCATCGTTTACATCGTTG
ATTGATTTTATGTCACTTATTGGAGTTGTGTTCTTTGTAAGTTTTTTCTGTAAATCATAA
AGGATCTTGAAAATGTTATTGTCATTGCGCAAGTACTCATGCATGGCATCTTTAAACTTA
ACCGGAAATATATTACATTCTCCAAATATTAATTCCAAGTGTGCTGGATTCATTAGTAAT
TGATTGTAACAGTACTTAGTGCCTCTACCCTTAAATGCATTATGAGTACAGTTCCTACAG
TAATCTGTATCATAGTATAACCATTTAGGCTTCAATTCTAAAATAACTGTTTGCAGATTT
TGTGAACAATAAGATTTTAAAAAGTGGTTATTTAATATCAGATTTGAGGTATTATTGGTG
AGATTTTTAATTTTGATAACTTTGACTACCTTATCGTCTAAATTTAGAATAAAGTCACTG
AGAATTGGCCTTATAGCTTCTATATCGACGTCAATCAGATACATCGGGCAAAGCAAGCCA
TGTAGAAGAGGTTCTACATAATCTTTAATATAACTGATGTTTTTGATTGTATAAGAATTA
TTTGATGATAACAGATCGGGCCAACGGATGCAGCATCGCCACAACCACGTAGGATCCCCA
TAATCAATCAGTATATTTGCCCCACCACGTCCGATGACTTGCATCGATCTTTCTTTTCAA
AAAAGGAACTTATCTCTGACAATTTTCGACTGGTAGCATATCACGGTTCGAATTAATTTT
GGAAACCCTAAATGGGACCGCATCAAAAAAGTACCTTGTGAAAATATCTTCGATAAATAA
ACCACTGAGGAACGAACAAGAAAACCATAAGTAAGTGAGG
Chr coordinates Chr IV from 1093763-1095178
w3c xhtml validator w3c css validator