Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YFT2
Systematic Name YDR319C
Alias FIT2A
Strain S288c
Description Putative protein of unknown function, identified as an ortholog of the highly conserved FIT family of proteins involved in triglyceride droplet biosynthesis; interacts with Sst2p and Hsp82p in high-throughput two-hybrid screens
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YFT2 YDR319C
CGGTGAGTACTCTAAGTCCATAGAAAACTCCAGCATGGCTTTGGAATTATTCCCATCAAG
CAAAGCTAAGTGGAAGAATAAAATCTCAAATAGTGACCCTGAAAGATCATTTAACGACAT
CTGGCCAAAGATTATGATTAGGCGTGCTGAGTCTTTTGAACATTTAGAAAGTTTCAAAAA
AGCACTAGAAACATACCAAGAGCTGATTAAGAAGAATTTTTTTGATGATAAAATCATGCA
GGGAAAAAGAAGATGCCAAGACTTTATTAATCCTCCCCCTGTTAAAAAATCCATGCCCGT
TAAGAAGAAGACAACGACAACCTCGCCTGCAACAAAAAAACAGAACTTAACCGCTTCTTC
TTCAAATTCTCCAATTTCTGTTGATAGCACTTCAGAAATAAAAAAACGGGAGCTAGAAAA
CGCTAAACTGGCGCTATATGATAAAGTATTTGAGAAAATTAGCTCCTGGAAGGATGGCAA
AGACGATGACATTCGTCATCTGTTAGCAAATTTATCCAGCTTACTAACATGGTGCAATTG
GAAGGATGTCTCTATGCAAGATTTGGTTATGCCTAAGAGGGTCAAAATTACATACATGAA
AGCTGTAGCCAAGACACATCCTGATAAGATACCAGAGTCCTTGTCCCTGGAAAATAAGAT
GATTGCAGAGAATATTTTCAGTACTTTAAGTATTGCTTGGGATAAGTTCAAACTGCAGAA
TGACATTAACTGATTTCCCTTGTGTGCCTGCTTCGCTCAGTTGTTTTTGATATGTACTTT
ATACAAATATATATAGGAAAACAAATTCTTCAAAGCGCGTTAGGAAAAAGTATGGAAAGG
CTTAGTTTCATTTATTGACTTACAAGTGGCACCCAATTTGATTAATATGAAAAACAATCT
GCAAAAAAAAAAAAAAAATTCAAAATATCACAATGTTAAAACACAATAGAAATAGGGCAT
TGTATTAAAACCACTGAACGACTAAAAATTGAAAAAGATT
Chr coordinates Chr IV from 1105827-1105003
w3c xhtml validator w3c css validator