Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YDR340W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR340W	6320547 upstream sequence, from -1000 to -1, size 1000
GTTATGAAATTAATATACATATAAACCAAAAACATTGCACTACATACTTAAAGAGTGAAT
ACACAGTAGTTTAAAAGACATCTGGCAATTTTTCAATGACGTATGCGTGACCGCCTACGC
TCATCAAAGGAATTCCAGGGATTTTTCTAATTCTTTGTTTCAGGCCGGCATCGTTTGTAG
CTACGATGTAACACTTATGTTGTAAGACTCGATGCACTAAACAGTCATCCGCGTACGTAC
CCTTGTGCGAACAGCTTAGTCTCTTTATTCTAGGATCTCGAGCCAGTTTCAAGGCGATAC
GGTACTTGGGGCCCAATTTTTCTAACTCTGCCATCACACAATCTGTGATTAACGGGTTAC
ATTTTGCGAGTAGACAGTCCATCATTCCTCTAACAATATCGACTTTTTTCTGGATAGAAA
AATTTATAAAATTGGTATCTATCAGTACTTGATAAGGTGGCTTTATAGCTTGATTGTATT
GAAAGAAAAGTGCACTTGATACTTGTGGTATATTCCTGGTTAGCTCAGGGTCTTCTTTAG
TTTTGATATTTTCCTGGTTTTTCTTCAATCTTTGGTCTTTCTTGGTGTTCAAAGTTCTTT
TTACGAGGCCAAACTTTCTTGTTTTCTTAGCTTTACCCATAATTAACTGTTGTAGTATAT
CGATATTTCCGTTACAAGTCACTGTTATTGTGTGTTAATGCACAGTAATGTTTAAAGAGG
CATCATTCAAGAATAGTAGCAAGCTGAAAAATTTTAGCCGTTCATAATGATACCTTTAGA
AATATGCCAAATTTTTTTGTTATATCTTCCAGTAGGAACCGATAGTTTGAGTAATGTTTA
TAAAATCATTGCAAGTGAATAAGCAATTAATGGCAATAGTCCACAAACGATAGGTACATG
AAGGTGGCTCACAATCAAAAAAATCAAGCTTTAAAATAGTGGATGTAGAAAAAATAAAGT
GCGTCACAGACAGGATTCGAACCTGCGCAGGTAAAACCCA
Chr coordinates
w3c xhtml validator w3c css validator