Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TRP4
Systematic Name YDR354W
Strain S288c
Description Anthranilate phosphoribosyl transferase of the tryptophan biosynthetic pathway, catalyzes the phosphoribosylation of anthranilate, subject to the general control system of amino acid biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRP4 YDR354W
CCATTTTCAGAAACAAGCCATTGGCCGTCATTGGTGGTGGTGACTCTGCATGTGAAGAAG
CTCAGTTCTTGACCAAGTACGGCTCAAAAGTGTTTATGCTTGTCAGAAAAGACCATTTGC
GTGCTTCTACCATTATGCAAAAGCGTGCTGAGAAGAACGAAAAAATTGAAATCCTTTACA
ACACTGTTGCGCTAGAAGCTAAGGGGGATGGTAAATTATTGAATGCCTTGAGGATTAAGA
ACACTAAAAAGAATGAAGAAACCGATTTGCCAGTCAGCGGTTTATTTTATGCAATTGGCC
ACACTCCAGCAACAAAGATTGTCGCTGGCCAAGTCGACACTGATGAAGCGGGCTACATTA
AAACTGTCCCAGGCAGCTCATTAACCTCCGTTCCAGGATTTTTCGCTGCTGGTGATGTTC
AGGATTCTAAATACAGACAAGCTATTACTTCTGCTGGCTCTGGTTGTATGGCCGCTTTGG
ATGCTGAGAAATACTTAACTTCCCTAGAATAGATGAATTTTCCATTATAAAATAGATACA
CTCAAATTTTTGTATACTTATCCAACAAATCGTTACTTTCTCCTTTTCTTTAATAAAAAG
CAAACCATGAATTTTATTTCTTTTCCCCATTATTAGAGAAAGCCAATACATAATCTACAT
ATATTGCGTGTCTGAATTAAACTTTTTAGACACATGACATAGGCCATCGGCTTACTTTGT
AACGCGTGGTTGCCTATACACCGACTATTAAGTTATGACTAATATTATTGCTGCGCTTCC
CCACCTGCATTTTTCTTGTCGTCTTTGCCAAAAGGAAAAAAAAACCTACGCAGATTGACT
CTCTAAAAAATGATTCATGACCAGACAATTCAGTAAACATAAACTCTGTTGCATTCATTC
TTCTGGAAAACTTTATAATAAAGCATCTGATATTACAGCTACTGACAACTAAGTGAATTT
AAACTGCAATAATCACAAGAAAACTTAGTATTCCCTTATC
Chr coordinates Chr IV from 1184747-1185889
w3c xhtml validator w3c css validator