Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BCP1
Systematic Name YDR361C
Strain S288c
Description Essential protein involved in nuclear export of Mss4p, which is a lipid kinase that generates phosphatidylinositol 4,5-biphosphate and plays a role in actin cytoskeleton organization and vesicular transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BCP1 YDR361C
GATACAGTCGTCAGTACAGTTGCGGTGGACGGCTACTTTTACATTTTCAATCCAAAAGAC
ATTGCTACAACAAAGACCACGGTGTCCAGATTCAGGGGAAGTAATTTGGTTCCAGTTGTT
TATTGTCCTCAAATCTACTCGTATATTTACTCAGATGGTGCAAGTTCCTTAAGGGCTGTG
CCGTCTAGGGCTGCTTTCGCAGTTCATCCTTTAGTGTCGCGAGAGACGACCATAACGGCC
ATTGGGGTGTCAAGATTACATCCAATGGTCCTTGCTGGATCAGCAGATGGAAGTCTTATT
ATAACCAACGCAGCTAGGCGCCTTTTGCATGGCATTAAAAACAGTTCAGCAACTCAAAAG
TCATTAAGGCTTTGGAAATGGGATTATAGCATAAAAGATGACAAATATAGAATTGATAGT
TCTTATGAAGTGTATCCGCTGACGGTCAACGATGTTAGTAAAGCTAAAATAGATGCGCAC
GGCATTAATATAACATGTACAAAATGGAATGAAACGAGCGCTGGAGGCAAATGTTATGCA
TTTTCTAATAGTGCTGGACTATTAACACTCGAATACCTGTCATGAGATGGACTTTACGTA
ATAAATACAATTTGTGACATTGAACTATTGTTGACGAAAAAAACTATCTTTTTTTATTGA
AATGAAAAAGGAATAAAATAGCCTAATGTAAAATATCGCCTGGCTAGCACTAATAACTTT
GAGTATTGTTGCAGTTATTCCTGCCGCAAATTATGTATTAAAATTTATACAGATATTGTG
CCATAACTTCAGTTAAGGGTAAATTATCAAATTCTCGATATCCGTGGTCACTTTATACGA
GTTTCTCTTTCCGTGCCTATATTCCTCGCGATGAGATTGAGGTAGAAAAAATATCTGAAA
AAGAGTTGTCAATATATTATCTATTATGTCCTTATAATTTTATCATTTAGATTGTTCATG
AGGCCCACATTTTCATAGGATTGCTAATTAACTCACAAAT
Chr coordinates Chr IV from 1196263-1195412
w3c xhtml validator w3c css validator