Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TFC6
Systematic Name YDR362C
Alias tau 91
Strain S288c
Description One of six subunits of RNA polymerase III transcription initiation factor complex (TFIIIC); part of TFIIIC TauB domain that binds BoxB promoter sites of tRNA and other genes; cooperates with Tfc3p in DNA binding; human homolog is TFIIIC-110
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TFC6 YDR362C
TCATCGTTTTCATCATAGGTATACAGTAATGAACTTTTCTGTCGCTTGTATTTTCCCGCT
GGAGATATTGATCTTATGCTTGACCTGGACCTTGACCTAGATCTGGGAAAATTTTTGTCT
TCGTCTAAGTCAGATTCAGATGAGTTTATTTCAACTACAGACTCTTTCATCACAGATCTT
CCTCTAGTTCGACCCGATGGTTTGTCTGGCTTGGGCTCCGTAATATCTTCTATATTTACA
TTTTTACTAGATGATCTGCTCAGGGACTGATGTTGTTCCTTTGCGTCGCTATCTTCACTA
TCAGATAATGTTAGAGTTGAATGCTTTGATGGCGGTACCGTGACTTTAGAGTCAACTATG
ACACTTTGCCTATTACTTTCATCGCTATGATCGATTTCATCTATATCATAGGAATTGTCC
ATAAAGAAGTCATCGCTGTTTTCATCAGAAAAACTTGTATTATCTGGATCTAGATTAATT
GAGGGTTCGCTGATGCTTCTGGAATCACCGGTCATCTGTTAACAGCCTAAAACAAATGAT
TTTTTCTCTTGCCTTTTATTGTTCAGGGCTATAATCCGTGTTCGCAATCACTTTAAAATG
AATTCTGAAGTAATAATGAAAAGTTGTTCTATTTCAATTGCGATATACGCTGTCAAAGTG
ATATATGGTATTGGGAATTCATAGGCATGCTGGTCCCTCCTCTGCCTGTCATTTCTTTTC
TTATATGCTACAATAAAATTTGCTGTCTTCTGTAAGGAAATAGAAGGGATTCAGTATCAC
CCGGAAAGCTGCGGTTCGAAAACCCTACGTTGCAAAAGAAGATAAACAACATTCCATTTT
TTGTTCGAGAAAGCCTGGATGAGTTGTTAAAGCTTTGATTTCTACTCAGTAAGAGCAGTT
TCATGTCCTAAAAACTAAAGCTAGTACTCTTTGATCCATTAGCGAAATTTCTCTAACTTG
CTCCATTGCGATACGTGTAATAATATATTAAGTTGTGGCG
Chr coordinates Chr IV from 1198697-1196679
w3c xhtml validator w3c css validator