Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDR366C
Systematic Name YDR366C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDR366C YDR366C
AGAAAAGAAAAGGGTTTCACGGAATTGAATTGCAACCAAATAGGGAATTGCGTGCTATAT
AGTTTCCTTTTTCCTTTTTTTTCAAAATTACGTAAGAGCTACTTAAATACACACGTGATG
AAAAGTGACAATAGCATCAGTGAGAATGATTTTATGATGTCAGAATAGAAACATTTCTTC
ATCAGTGTAAAACGCTATAACGCTAGGGCTTTATTTTACTATTTACTCTAACAAATTCTT
ACATAGCTTATAACAACCTTTTTGGCTCTTAGCCCACAGTCTTTTCCAAATAGGCTTGTT
TTTCAAGTTTTGTTCTACGTCATCCCTATCAACTAAATATTTGGGGTGGTGTAACAATTC
TTGAACAAAAGATGCCAAAATGAAGTTAAAGTAGAACCTGAATATCAATGACACCAACGT
AATTAAAATAGTCATGGTATATTCGTAGCTTTCAGTTGCACTTTGTTTACTTATATCAAT
ACCACGTTCTGTCAGCTTACCTGTCGATATTGGGTTACTTTGTAGTGCATTATTTCCATC
AATATTAGCAGTGTCTTCCAAGGTGAACCATTGCGTGGTAAACCATAGAGTAAAAAAACA
AGTGGAAATGGTATCGATTGTATAAAGTACGCAGATTTGCGAAAATACCAGCAAGTTTGG
CTTATGAATCAAATACAGCCCTTGTGAGAATACGATTAATGTAAATACCGACCAAAGATA
TGCTATCCATTGCATAAAATCCAACGGATGACCCGTGAACAATGCTAAAATACCATAAGC
ACCACTGCATTTGTTTAGAATGGAAATACCTAAGACAATCTCAACTGCAAGGTATAGCGG
CATAAACCCCAAAAAAGACTATGAAAAAAAAATATGTTTGAGAACAGGTTAGTAAAATTG
TGCTTTGCTTCGAATCCTTACAAGTTAACAAAAATTTATAGCGTTTGCCGGAAACATACT
TTTGGAAGGGTTAGAAGAGATGATCTCATAACTAAGGTTA
Chr coordinates Chr IV from 1212836-1212438
w3c xhtml validator w3c css validator