Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DXO1
Systematic Name YDR370C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DXO1 YDR370C
CGAGGTTCTGATTCATTGTTACCAGGGAACTCCCAGTCTAGATCAATGCCATCAAATCCT
AATCTGAACATTGTTTCCACCGACGAATCAACAAAATTTTGTAAGAGTTTATCATCTTTA
ATTATGATTTTGAAATTTTCACTATCAGACCAGCCCCCAATTGACATGATAACTTTAAAT
TTCTTATCAGAACAGGTATTCTTCAAATAAAATAGTTCACCAATGCAACCTAAGGGTAGG
ATGTTTTGGACACTATTGTTCGAGCTTTCTTTAATTAGTTCTGAATTTTTAATTGCCAGC
GATTTATACAAATTCATTTCTAGATCAGACCAACTATCCGTGTTTTCTATACCACCAGTT
CTAGAGTTTATTTTGAAAAATGCATAGTAAATGTGAGACACTTGCTTCAAGTTTATGTCG
TGAGGGAAATGAAACCTCGGTTTGTATGGGGACCAATTGGAATAATAGACCCCTGATATA
AAGGCTTCGTCTCTTATATGGGTTCCATGATTTTGGACATTACTGGGAACTCGATGTCCG
CCATTGTTAAAGTTGTCTCTAATATCATCCGACCTTTGGTTCTTAAAAATTTTATTATAT
AAACACATTTCAATAATAATCGTTATAAAGATAAGTAGTATTAGTAGGTGAGACACTAAG
CTGCTTTTTGATCTGTGCTGAGCTGAGTGTCCTACCATATGATCACTCTTGTATCGTCTA
CTTATAGAGGTTGTTAGTACCAACCTGCAAATACAATTGTTGGACCATACTACCACAAAA
GGTTCTTTTCGTTGGTGTATCCTCACAAATAATGATTATTCCACCAAAATCACCAAATTA
TTGTGTCAAACTAACTGGGATTACCCCACTATTGATTTTTCCAGTTTTTCCGCAATTTTC
GCAGCATGTTTTACTTTTATAATGGCATTGTTGCATTACAGCGCCAGTTGTAGGTATCGA
TGATTTTATGTCAAAGTTTTCTTTCTAGCCAAACTCAGTT
Chr coordinates Chr IV from 1219110-1217782
w3c xhtml validator w3c css validator