Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO10
Systematic Name YDR380W
Strain S288c
Description Phenylpyruvate decarboxylase, catalyzes decarboxylation of phenylpyruvate to phenylacetaldehyde, which is the first specific step in the Ehrlich pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARO10 YDR380W
TAAACATAGGATAGATTAAATAAGAAATCATATGAAAAAAGAATAAAGTAAGAAAATAGT
TCAATGTATATTCGTCAGTTCAGGGTGTGAAAAGGTGGCAATTTTTTTGTTTCCGACCCG
TAACAAGTGTTCAATGGTGGTGAAGTCTTTTCTTGGCAAATTTCTATACTTCCCAAATTC
TTCATGAATATAATTCACAAAATTAACTTGGTTTTCCTTTGGTTTTGTATGAGCCGTTCG
TATGGAAGCCCTATACAGGTGTAAGACTTCTTTTTGTAACCCACTTAATCTCTTAGGCAT
GCTCTTGGTATTGCGTCTCCTCTTCTTCTTGTGTGTTTAAGCTACATTATCTTTGTTAAG
AATAATTTGGCGAACCCCTTTTTTTCTTCGGCTTTGCAAGGTTAATTAATTAACATCTAC
CAGTTTTACTACATTTTAGATTGGTTCGTCCACCGAAATTTAAAAAAGCAGGATTGAAAG
CGTACAACAACGTCTTAGCGAAAAAGATAATCCAAAATTCGATGCTTGTACACCTCATGT
AGCTTCCTTATTAACATTTGGTAGTAGGCTTAGGCTATTTTTTGAAAAAGCCGTCATATA
TTACTTTGAGCCTTTGCGAATCCTCTCCAAAGTGTCGGTTACCTACCGGGAGGGATAACC
GCGGATAGCCGTCATTTACCGAAAATTGCCGAGGTCATGCTGAGCATTTGTCGTACTTTT
GTGCGGCGGAGCTTTGATACCTTCGGTAAGTGTCGGTATGTAATAGGTTAGTGGCATCTT
ATTTATTGTGTTGAGTAAAGTTTAAGATATAAACTGGGCTAGTTTGCATCGTCACTACAG
CGGCAGCTCACTTTCATTTTTTTTCTGCGTTTATTAATACTACATAAAATCTGATATAAA
ACATATTTAACTGATCAACCCTCTCAACTTGATACTCAAAACAAGTTGACGCGACTTCTG
TAAAGTTTATTTACAAGATAACAAAGAAACTCCCTTAAGC
Chr coordinates Chr IV from 1234218-1236125
w3c xhtml validator w3c css validator