Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATO3
Systematic Name YDR384C
Strain S288c
Description Plasma membrane protein, regulation pattern suggests a possible role in export of ammonia from the cell; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family of putative transporters
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATO3 YDR384C
AGCCTACTGCATTGTAATACCTGAAGAGAACAAACCATAACCTGGAGGACAACAGCCCAG
TGTGCAGGGAGATCTGAGAAAGAAAGGAACCACACGAGAGACCCGAGAGGAAAGACCAAA
TCCCTTTCCCAAACTAGTTGTGTTTTTGTCAGGTTAATGCGTCTGTGTATTTCTCAGAAC
GCTTACGTTCCAGGTATTTCGCACCCATTTTGAATTCTCCATATCGTTTTGCACGGAAAA
CCCATTTATCATCTATTCTGTATATAACCACAATAGGCATCTCATTTCTTGCTTTGAAAT
AGTAGGTACTTTTGTACGTAATTCTTCTGGTAAAAAAAAAAGAAAAAAAAGGAAGGAATT
TGGGTCTCAATTTTCACCCTTTTGTATAACAGTAGCATTCTTGCATGTAATCTCCAATAT
TTGGCTTGTGATTGCCATCTCTATACTTCGTCAGCCATTACCTTTTCCCCTCCCCTTCCC
CTCCCCTCTCCTATTGCCGCACCGCCGGCTACAAACATAACTCCAACCATAATCTCACCG
CAGCTGGCATATCCTCCGGTTTTCCCTCTCCATCGCCCATTGTGTGCCAGACAAAAGACG
CCGAAAAAAACCGGAACTGCCGCCGCTGGTCCTGAGAAGAGCAAGAACCATACGGAAGAG
TCTCAGCAGGCGCTGCTCCAACTTGGCACACGGCAGAACCTGCACTACAATAGCGTTAGG
AAGAAGCATCATTTTTTTCTACTGTTTTTTTTTTTCTTGGGGAACCGCTCAGGGCCTAAT
GGAAACACCAATGGATTTGAGAATTTTAACGCTATTCACGATGACCGTGACTCAGAAGGA
ATATTTAAATAAAACAACTTTTTAGCAAATTGAATACTCATCGATGAGCTTCGCTTGATT
GCCTAATATTCCCCCAGTTTTATAAACAGTTGGGTCACATATAACTGAATACATTCCCAG
AAAGATTTAGTAAGAATAAAAAATAAAAATACTGGTTAAA
Chr coordinates Chr IV from 1242031-1241204
w3c xhtml validator w3c css validator