Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SXM1
Systematic Name YDR395W
Alias KAP108
Strain S288c
Description Nuclear transport factor (karyopherin) involved in protein transport between the cytoplasm and nucleoplasm; similar to Nmd5p, Cse1p, Lph2p, and the human cellular apoptosis susceptibility protein, CAS1
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SXM1 YDR395W
CAGGTACCGGTAAGACGATGCTTGTTAAAGCCGTCGCCAATAGTACAAAAGCTGCATTCA
TAAGAGTTAATGGCTCCGAATTTGTTCACAAATATCTTGGTGAAGGTCCAAGAATGGTTC
GTGACGTCTTTAGACTCGCCAGGGAAAATGCTCCATCCATTATATTCATAGATGAGGTAG
ATTCCATTGCCACAAAGCGTTTTGATGCTCAAACGGGTTCCGATCGTGAAGTACAGCGTA
TCCTGATTGAGTTGTTGACACAAATGGATGGTTTCGATCAATCCACCAACGTTAAAGTCA
TCATGGCTACAAACAGGGCAGACACATTGGACCCAGCTTTGCTGAGACCAGGCAGATTAG
ATAGAAAGATTGAGTTTCCCTCACTTCGTGATAGGCGTGAACGTCGTTTGATTTTCGGTA
CCATTGCCAGTAAGATGTCCCTTGCCCCAGAAGCGGACTTAGACTCGCTTATTATTCGTA
ACGACTCTCTATCAGGTGCTGTTATTGCAGCGATCATGCAGGAAGCTGGTTTAAGAGCAG
TGAGGAAAAACAGATATGTCATCTTACAAAGCGATCTGGAAGAAGCTTACGCCACTCAAG
TCAAGACAGATAATACCGTCGATAAATTCGACTTCTACAAATGATTACCATATATGCTTC
AACGTAGGTCTACATAAAGTATTACGTACATTTCTATCTAGACAACACTAAATGAAATAA
ATACAGACGCCACTTTTTTATCACGTTTCTTAGCGTTATTCCGCGCGCAACCGGACGTCG
CTAGCCAAGTTTTTCACTTTTTTTTTTCTGTGATATTTTTTTTTCCAAATGAGATGGTAA
GATGAGTACCTATCAACAAGTATCTCAATCAATAAAGTACAACCAAAATATCAAGTACGC
AGTCTCTGCTTCATCCCAGTGTAGATTTGCTATTCGATTTGTGTCATAAACATTTAACAT
TGCGCCCGTCTACAACAAAGGAGATAAATCAAAAAAGGAA
Chr coordinates Chr IV from 1263324-1266158
w3c xhtml validator w3c css validator