Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NCB2
Systematic Name YDR397C
Alias YDR1
Strain S288c
Description Subunit of a heterodimeric NC2 transcription regulator complex with Bur6p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2beta
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NCB2 YDR397C
TTTATTCTAAAATGTTGTAACAGTTTGAATTGTAACAGATCGAACTGATAGAATGCGTCG
CTGGAGTCGATACACCACAGTTGATTACCCATCAAGTCTATGTCTTTGATTTCGTAAGAA
TTCCCCGTAGTGAATTTATAGGTGACTTCGTTGGCCAATACGGAATATAGCCAAATTTCA
CCGTTATTCATACCCAATATAATAGCCACTGTGTCGGAAGAAGCCAGGTTTACCCATTTT
AAGCACGTCACCTTCAATTTCGAGTCCTCTAAATACAGAAAATTCTCATTCCACACTGTA
TCAACTCCGGAGGAAGTGGCCCTTTGAGTGGGCTGTACACCAACGCGTTGCTTGTCCAAA
GCTACAGTGACATAACACAAATACTGACCTGATGGGTCATAAGCGGACTGTAGAACAGGA
GAATCCATCGGTAATGAACAATTATAAGGCAAATGTGTCTTTTACCCTCTTGCTAAGCCA
AGTTTAAACTATATATGCTCTGCATCTATCTTTACATACATATATCCTATCCAATACTTG
TTAATTTTTTCACCTCATCGCTTCAGCTGCGAAAGATTAGAAAAAGAAATGAAAAAAAAT
TGGATAAAATTTTTTTGTCAAGAAGCTCATCCCCGTGTTAAATGACAATCAAAGAATAAG
GGGAACTGTACAACACGTTCAACCAAAACTATTGTAAAGAAATGCCACCACTATGCAGCA
TAGCCTGTTCATGCGAATAGTCGCCGCAAAAATTACGATCTGGTTTAATCAGCTCGGGCT
CTTATCTTTGGCGTATTCCAGTATGTGCAATTAACTCTTGCACCACTTTAAAACGCCCAG
CCCGCTGCACTCTCCCTCCTATATAAATGGAAGCGGTTTTTGGTCGCGCTTTTCGCCCTC
TGCTCGCCTTGTCGATTTCTATCGTGCAGAGTTACCAGTATAAGGTGGGCAAGAAATCAT
AACGATATTTACTAATACAGTTGTACCTATTAATTAATTG
Chr coordinates Chr IV from 1266769-1266366,1266898-1266862
w3c xhtml validator w3c css validator