Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PDR15
Systematic Name YDR406W
Strain S288c
Description Plasma membrane ATP binding cassette (ABC) transporter, multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PDR15 YDR406W
AACATGGAAAAGTACCGTGAAGAAAGACTTAACTGCTTGGGCTCAGACGCCAACAAACCC
GGCACAGCATTCGACGGAGTCGTGGGGCCTTACGAACGGGTGGCCCAGCCTTTTATACCT
CGCTTCTTAAAACGAGAGATAGACAATAAGCGAGAGCGTCACGCCGCCGAACTGCAGCGC
GCAGATAAACTAATTGCCCTGAACAGGTACATAGAAGATCTACATTAGAAGGTTTCCCAT
TCCACCCCTTCGTTAACCCACACGCAAATACCCAGATAAGCATCTTGCACCCCTCACACT
TGTATATACGGAGCAAACTACATAATCTCTAAACAGAAAAAAAAAAAAAGAAAGAAAATT
AAGAACATTACTTTTTCCGAGCAACAAACGCAAAAATATATGAAGTGGCTGTAGAACATG
CCTTACGGAAGAAAAGAATGATGATGGCATCCCCTTCCCCTGCCCTGGAAGGTGGCCTGT
ATTTCTGTTCTTTTTTTATTTTTGTTCGCGCAAAGAGCAAGAACATTGGTTGCTTTACTT
ATTATTTTCAGGGTCGCTTCCGCGGGATGCCATGCACGGATGCCTGCGGAGACAGTGGCG
CGGAGCCGTCCGCATGCTCGTTCCGCGGAGAGTCTCGAGCGGGTCCGCGAGGGGCGGATC
TGCAACGCACGGTGCCGGGGTTAAGGTATGGCACGATGGTAAGACGATGAGGGAAAAGAA
TACTGCTACTGCTGTGCGAGACTTTGGTAGTAGGGATCGGAAAGGGAGCATGTACATCTG
AGGAATATATAAGCAGGAGCTCTCTACCTGGACCAAATTGCCTTCTTATGTTGCTGTAAA
GAGATTTGCTAGTCTTGTTGTAGATACGTCATATGCAGTATTCAAGTATACTACTGTTAA
GAACATCACATCACTAATACTATTAGCGTATAACAGTTACTATACGAATATATAAACACA
CACACACACAAGCAAACACACTTATAATTATCAAAAACCT
Chr coordinates Chr IV from 1279210-1283799
w3c xhtml validator w3c css validator