Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRP17
Systematic Name YDR412W
Strain S288c
Description Component of the pre-60S pre-ribosomal particle; required for cell viability under standard (aerobic) conditions but not under anaerobic conditions; exonuclease required for 5′ end processing of pre-60S ribosomal RNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRP17 YDR412W
TGGATCAGCTTTTCTGGATATCATCCCCCATATTGGCCCCAGTGTATGGGTATCTAAGCA
TGTATAAAGGTACCCTGTAGTAAAACCGATCAATGAGATTACGAAATCACCCTCATTAAA
AACGAAAGAGATAAACAATTGAATTAAGGGGAAGTACTTCCCCCAAACAGGAATCAAACC
ATAAAACATGATCTGCACGTTGGCATTGTCGATCGACCAAGTATATGTAATGCATGATAT
GAACCCAGAGGTGAGCACAACAGGGTAGTAGGACCCATAAATGATTGTAGTGGCCGTAGT
GATGGCTAGTATACAAAAGCACAGGTAGTAGGCATAGTCTACTGTTACCATCGGTCCTCG
TCTATTGGACAAACCGGGACCAAAATGCCCTCGCTCCAACTGTGAGGACCTGTCATAAAT
ACTATATAGTTCCATTAGCGCAGGCATGGCACGAGACGAAAGCATTACACAAGAAGTAAG
AAGTCTCCATATCTGAACCTTCTTGAACGTCAAATTCCAAACATAAATAAAGTACCACGG
ATTGATTAGATTCAACCGGCCGACGATCGTCATAACGATCGCTAGAGTAAATAAAGTTCT
TGTTATTGGGGGGATATTTAACCAGAATTCTTTTGGGCCCATCACATCATTATTACGGCC
TCCATTTCCATGTAATGTACGCACATTCCTTGGGCCTGCCATTATTTCCTCGAAAATAGT
TTTTGATTTGACTTGGAAATGCGGAATTCACTGGTAATTTGTTGTATTTTGCCTTATATC
CTTTGTTTGATACTCTTGTCTTATATTGAAGAGGACACGATTTCATGAGCCGCGAACGGG
TAAGTAGGGACTTTTCACATTTGAAATTTTTCAAATGTGATGAGGATCGATTCTGCAAAG
CAGCAGATAATAGCAGATAAAAAATAGAGAGTTGCAATATTCAAGTTCCTGGTAGCTGCT
CGAATCAAGAGGGGTGAATTAAAGGTTTTCGATTTTTGCT
Chr coordinates Chr IV from 1294693-1295400
w3c xhtml validator w3c css validator