Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIP1
Systematic Name YDR422C
Strain S288c
Description Alternate beta-subunit of the Snf1p kinase complex, may confer substrate specificity; vacuolar protein containing KIS (Kinase-Interacting Sequence) and ASC (Association with Snf1 kinase Complex) domains involved in protein interactions
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIP1 YDR422C
AAGAGAATGAGAAAGTTATGTGGAACATAGGCTCATGGAACGCTCCCAGTTTAACCAATT
CGTGGGATTCTCCCCCCGGAAATCGAACAGGTGCCGTTACCATCGGTGACGAAAGTATTA
ATGGTAGTGAAATGCCAGATTTCAGTCTCGATCTTGTCTCCAATGATAGACAGACTGGTC
TAGAAGCTTTAGATTACGACATTCATAACTACTTTCCTCAGCACTCTGAACGCCTGACCG
CTGAAAAAATAGATACGTCAGCATGTCAATGTGAAATTGACCAAAAGTATCTTCCATACG
AGACAGAAGATGATACTTTATTCCCCAGCGTGCTTCCCCTTGCTGTAGGGAGCCAGTGTA
ATAATATTTGCAACCGCAAGTGTATCGGGACCAAACCATGTTCAAATAAGGAGATCAAAT
GCGACTTAATAACAAGCCACCTGTTGAATCAGAAATCTCTAGCTTCGGTGCTTCCGGTGG
CTGCTTCTCATACTAAAACAATTCGAACCCAATCTGAAGCAATTGAACACATTAGCAGCG
CCATATCGAATGGAAAAGCGTCTTGCTACCACATTCTCGAAGAGATCTCCTCCCTACCAA
AATATTCATCGTTGGACATAGATGATTTATGCAGCGAATTAATAATCAAGGCAAAATGTA
CAGATGACTGCAAAATAGTAGTCAAAGCTCGCGACTTACAGAGTGCTCTGGTTAGACAGC
TCCTGTAGCATATAAACATATCTTGAGTATACATAATGTTGGATGAGAGCATGTAATATT
GATCGCTTTGTACGATGATTATACCTTTTTTGTCTTTTTACCATTGTCTCTGATGGAATA
CTATTGACAATTAACAATGGTAGATATATCCGATACAAGTGGATACCTACATAAACAAGG
TGTCTTACCTAGTGTTTCTTTCATTTGCACTTCTTTTTTTGCGTGTGGACTGACATCTTG
GAAAGTTGAACTGTCATATTATATAGTTGTTGCAGCCGCC
Chr coordinates Chr IV from 1317773-1315326
w3c xhtml validator w3c css validator