Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name APT2
Systematic Name YDR441C
Strain S288c
Description Apparent pseudogene, not transcribed or translated under normal conditions; encodes a protein with similarity to adenine phosphoribosyltransferase, but artificially expressed protein exhibits no enzymatic activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>APT2 YDR441C
CAGGACATCCATGGAATAGTATTTCAGCACCCGTTCCCACTGGCACACTCACAGCATCGC
TGTGCTATTAGGAGTGGTGCTTTGATCAAATTCAAAAAATGCGACGGTGATACGGTTTGG
GACAAATTCGCAGTCAACCTTTTAAACTGTCCACATTCTGATAGTACACAATTGCTGGAA
ACCATCTTAGAAGAGTTTCGCAACCTGGCTGCTCTAAACGTGTGGTACGGTCTCTCTGAT
GGCGAAGATGGCCATATTCCATGGCATATCCTAGCCGTGAAAAAAATGATGAACACTCTT
GTGCACACCAGAGTAAAAATTGCTAATACTTCCGCCGCTACTGTGCATACCGCTACTTCT
TCATCAATTATTCTCTCGGATAAATAAACTTTTTCCGGCAACGTTTTCCTGCTCATCTGT
AGCCCTATTTACCAGTTTTGGTTTTAGTATTATTCCGGGGTGTAAACCCAGAAGTCTATT
TCTCCAGTCGGATTTATAAAAACAAAACCGGAAGCGGGGCGGTACGGCATTTTCACTGGT
GATGCACGCCCAGCGTGTAGTCCGAGACAATTTCCACAGAACGCGAATGAGATTGCGTTT
AAGGCTGTATTTTCAAGGCACACGAAGCGGCCACGTGGGTCTGCGATGGTGTGTTGATGA
TGTCAAGAATGGTATCATACTCCGTATAAGGTTATGTAATCGGAAGTCGCGATTCTTTTT
CAATTTTTTCTTTTTATTTTTTTCCAGTTTTTTCGTCTCTGCGATGGAAAATTGTTGAAG
TTCTCTTGATTAGCAAGTAGTTCTTACATCGCAGGAATCTTATGTTGCATAGCTCAATTT
ACAAAAATAACAAGGATAAATATATATATATACGCATATACTTTTTGGGTGTTAAAGTAA
ATTTTGCACCCGTTCATACCAATCGTTCAGATAATTTTCGCTCCTTAAAAAAAGAGAGTG
CGTGTGTATATGCCTGTTCATTGCCTGTCCGCCTCTCATT
Chr coordinates Chr IV from 1345062-1344517
w3c xhtml validator w3c css validator