Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MFA1
Systematic Name YDR461W
Strain S288c
Description Mating pheromone a-factor, made by a cells; interacts with alpha cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C-terminal modification, N-terminal proteolysis, and export; also encoded by MFA2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MFA1 YDR461W
CGGGATCGATGTGGCTAAGACCGAGGAGAAACTACGCACCTACGAGGAATTAAACAAGCA
ACTGATTATGAATAACTTGGAGAGAAGCAGAACAGAGATAGAAAGTTTCGAACAGAGACA
AAAATTCGAAAAGGAGATGAAATTGAAGAAGCGACTGTTGGAAAGACAAATCGAAGAGGA
GGAAAGAATGAACAAAGAGTGGACAAAGAAAGAAATCGTCAACCGGTTGAGTACGACCAC
CCAGGATATCAATGAAACAATCGAAGGCGTTAAAAATACGGTTAAATTGAAAAAATCGTC
CGCTAGAAGGAAATTGGAAGAACTAAATAGAGTTCTGAAAAACAATCCATATTTCAATTC
AAATGTGAACGTACAGAATTCGAGACTCAAAGATGCTGTACCGTTCACGCCGTTTAACGG
TGATAGAGAAGCACACCCAAGGTTTACGTTGAAAGGTTCAGTATACAATGACCCATTCAT
CAAAGATCTTGAGCACAGGAAAGAATTTATTGCGTCTGGGTTCAACACTAATTATGCGTA
CGAAAGGGTGTTGACAGAGGCATTTATGGGCTTAGGATGTGTTATATCCGAGGAGCTTTA
AAACATCAGGATAGTGTGCAACGTGGCATAAGCTATGTAATCAACTACTTTTTATTTTCT
ATGTACGCATATACATGCATTCACGATCTGTTTCAGTGTTCAGAAAAAAGGCACCTACTG
CTACGGTTGGCCCATACCTTTATTCTTTGTTCTTGTTACAAACGAGTGTGTAATTACCCA
AAAAGGAAATTTACATGTTAAATGAAACCCAGTAATCAGAAAAAACAGTTAAGAAACCTA
AAATGGTAGAGATAAAGATACAGATTCAGTGGTTGCTGAAAATCAAGTAAAAAAATGAAA
TAGAGTCTTCATATATAAACCGCCAGAAATGAATTAATGAGAGGGATCTGTAACTGTTTC
TCGGATAAAACCAAAATAAGTACAAAGCCATCGAATAGAA
Chr coordinates Chr IV from 1385176-1385286
w3c xhtml validator w3c css validator