Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO8
Systematic Name YDR481C
Alias phoH
Strain S288c
Description Repressible vacuolar alkaline phosphatase; regulated by levels of Pi and by Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides; contributes to NAD+ metabolism by producing nicotinamide riboside from NMN
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO8 YDR481C
TTCTACTGTTGGAATTCAATGTTAGGAGGAGAACAATAACCGCACCTGCAATGACGGTAA
ATCTCAACAGTCTCTTACTGAGAAAGAGGGCCATGCTTTCGAGTGGAACTGCTTGCGAAT
ATGGATATCACTTCCAGTATTATAGATTCATAAAATGTATAAACGAATTAAATCGCAAAT
TATCTCCTTTTCAGACTGTTTCTTCACCAAATTTCTTTTTTTTTTCCTACTAGAAGAAGG
CGTAGCAGATAAGAAGGAAAAATTATATTAAGCGTGCGGGTAAAGGCAAGGAAGAATCAA
GTAAGACCTCAAGAATGGCACTATAAGTGTGGTATTATAATCTGTGTAATCCTAATTTGA
GCTCTACACAATACCATTCGACGGTTAACAGCTACTGCATCACCGTCCAGTCATGTCGTA
CAACGGAATAGGGCTCAAGTCGGCAAAAGGGTCATCTACGTCGGGCCACGTGCAGCGATC
ACTTGCTAGCAACAATAGGCGCAGACCACAGGGTAGTCAACAGCAGCGGCAACAACGACA
AAATGCGATCAAAAAGGCCAGCCATGACAAGGCAAGCAGGCCTCTTGCTGTGCAGAAACA
GATAGAGACTCATATGGAGAAACGTGAGATTGAAGTACAAGTTAGCGAGCTACGGGACCG
ACTGGAGGAGGAAGAAACGCTCTCGGAAGAGCAGATTGACAAGAAATGTGAAGCGTTGAG
GGCAAAACTGACGAACGAGTGGCAAGAACAGCAGCGGATGTCCTCTTTGTACACCCCTCG
TAAGGCGCGTCTAACGGAAGAGCAGCATCGACATGAATAGCAGCATTGACGATAGCGATA
AGCTTCGCGCGTAGAGGAAAAGTAAAGGGATTTTAGTATATAAAGAAAGAAGTGTATCTA
AACGTTTATATTTTTTCGTGCTCCACATTTTGCCAGCAAGTGGCTACATAAACATTTACA
TATCAGCATACGGGACATTATTTGAACGCGCATTAGCAGC
Chr coordinates Chr IV from 1420250-1418550
w3c xhtml validator w3c css validator